]> Yu Lin "Asiyah" (Y.L.) Salwa Ali (S.A.) 2011-11-15 Arbor version; 1.1.50 Brucellosis Ontology is a biomedical ontology in the domain of zoonotic disease brucellosis that is caused by Brucella, a facultative intracellular baterium. IDOBRU: Brucellosis Ontology OWL-DL The Brucellosis Ontology (IDOBRU) as an extension of the Infectious Disease Ontology (IDO) Yongqun "Oliver" He (YH) Zuoshuang "Allen" Xiang release version definition editor note imported from definition source definition editor alternative term editor preferred term imported from is_denoted_by encoded_by encodes has_temporal_interval has_scattered_temporal_region lacks_part Proposed by Crusters et al in 'Negative findings in electronic health records and biomedical ontologies: a realist approach' published in Int J Med Inform,76 Suppl 3, S326-33, 2007/03/21. The relation lacks_part was defined in terms of the positive relation part_of, holds between a particular p and a universal u when p has no u as part. Y.L. has_spatiotemperal_interval hasDurationinDays what type we should use? for 6 weeks, 2 weeks, 3 weeks... and so forth has_gene_start_position has_gene_end_position has_strand either + or - has_data_resource has_gene_symbol has_COG_functional_category COG ID has been clustered by COG functional category. So one COGID may be assigned to 0-many functional categories. Those categories are described by a sigle letter from A to Z. There are 25 COG functional categories. hasAge brucellosis Rock of Gibraltar fever Bang’s disease Malta fever YH, YL, ZX Mediterranean fever undulant fever a zoonosis that is caused by Brucella. brucellosis symptom a symptom that is observed by a brucellosis patient. YH, YL, ZX human brucellosis symptom a brucellosis symptom that appears in human. Malta fever YH, YL, ZX cattle brucellosis symptom human brucellosis symptom a brucellosis symptom that observed in cattle. YH, YL, ZX a brucellosis syptom shown in a cattle. brucellosis cough a brucellosis symptom that appears as cough. YH, YL, ZX cough typically shown in a brucellosis patient. goat brucellosis symptom a brucellosis symptom that appears in goat. a brucellosis symptom shown in a goat. YH, YL, ZX swine brucellosis symptom YH, YL, ZX a brucellosis symptom that appears in swine (pig). undulant fever 'undulent fever' is often used as a synonym of human brucllosis. The exact use of this term requires some future discussion. a human brucllosis symptom that is usually characterized by nonspecific febrile illness, including irregular and intermittent fever and chills and is observed in 90% of brucellosis cases. YL, YH, ZX brucellosis arthritis PMID: 18045560 arthritis typically shown in a brucellosis patient. YL, YH brucellosis sweating PMID: 18045560 sweating YL, YH brucellosis hepatomegaly PMID: 18045560 YL, YH hepatomegaly typically shown in a brucellosis patient. brucellosis splenomegaly YL, YH PMID: 18045560 splenomegaly typically shown in a brucellosis patient. brucellosis anaemia PMID: 18045560 YL, YH anaemia typically shown in a brucellosis patient. brucellosis leucopenia PMID: 18045560 leucopenia typically shown in a brucellosis patient. YL, YH brucellosis leucocytosis YL, YH leucocytosis typically shown in a brucellosis patient. PMID: 18045560 brucellosis thrombocytopenia thrombocytopenia typically shown in a brucellosis patient. PMID: 18045560 YL, YH brucellosis thrombocytosis YL, YH PMID: 18045560 thrombocytosis typically shown in a brucellosis patient. brucellosis elevated CRP YL, YH an elevated CRP typically shown in a brucellosis patient. PMID: 18045560 brucellosis elevated ESR PMID: 18045560 YL, YH an elevated ESR typically shown in a brucellosis patient. brucellosis positive RF PMID: 18045560 positive RF typically shown in a brucellosis patient. YL, YH brucellosis arthralgia YL, YH arthralgia typically shown in a brucellosis patient. PMID: 18045560 brucellosis diurnal variation fever process YL, YH PMID: 18045560 Fever is the most common(92.8% of adults, 87.5% of children) feature of brucellosis. There are no characteristic patterns which differentiate fever due to brucellosis from other febrile illnesses. The temperature usually shows diurnal variations, being high in the afternoon and evening and returning to normal in morning. This diurnal variation is of clinical importance as the treating clinician may find the temperature to be normal if the patient is seen in a morning clinic. The fever tends to subside if the patient rests in bed, and rises again following physical exercise. The temperature may be of a low grade and the patient may be unaware of its presence, and it can only be detected during hospitalization and regular measurements. The temperature usually ranges from 37.5-40C or higher. P76 Madkour, M. Monir, Brucellosis, 1989, ISBN 0-7236-9041-1 brucellosis chill chill typically shown in a brucellosis patient. PMID: 18045560 YL, YH brucellosis anorexia anorexia typically shown in a brucellosis patient. PMID: 18045560 YL, YH brucellosis malaise PMID: 18045560 malaise typically shown in a brucellosis patient. YL, YH brucellosis asthenia asthenia typically shown in a brucellosis patient. YL, YH PMID: 18045560 brucellosis weight loss YL, YH weight loss typically shown in a brucellosis patient. PMID: 18045560 human brucellosis brucellosis that is beared by a human. YL, YH swine brucellosis YL, YH brucellosis that is beared by a swine (pig). horse brucellosis brucellosis that is beared by a horse. YL, YH cattle brucellosis brucellosis that is beared by a cattle. YL, YH sheep brucellosis brucellosis that is beared by a sheep. YL, YH Brucella virulence factor YH, YL, ZX virulence factor that bears Brucella virulence factor dispositon brucellosis test PCR primer PCR assay for detecting B. abortus gene BCSP31 PubMed: 11574607 A PCR test for brucellosis that is a single step PCR for the detection of a 223 bp region encoding Brucella abortus protein BCSP31 in peripheral blood samples is used in the diagnosis of human brucellosis(Casanas et al., 2001, Quiepo-Ortuno et al., 1997). The same PCR test can also be used for samples from focal lesions. YL, YH B. abortus specific primer for AMOS and updated AMOS sub acute disease course YL an acute disease course temproally lasts up to a week. submit to OGMS later B. abortus specific forward primer for AMOS and updated AMOS Sequence: GACGAACGGAATTTTTCCAATCCC B. abortus specific reverse primer for AMOS and updated AMOS Sequence: TGCCGATCACTTAAGGGCCTTCAT B. melitensis specific primer for AMOS and updated AMOS B. melitensis specific forward primer for AMOS and updated AMOS Sequence: AAATCGCGTCCTTGCTGGTCTGA B. melitensis specific reverse primer for AMOS and updated AMOS Sequence: TGCCGATCACTTAAGGGCCTTCAT B. ovis specific primer for AMOS and updated AMOS B. ovis specific forward primer for AMOS and updated AMOS B. ovis specific reverse primer for AMOS and updated AMOS B. suis specific primer for AMOS and updated AMOS B. suis specific forward primer for AMOS and updated AMOS B. suis specific reverse primer for AMOS and updated AMOS brucellosis diagnosis by PCR test YL YH,YL brucellosis diagnosis made by using PCR test method RB51/2308 primer for updated AMOS RB51/2308 forward primer for updated AMOS RB51/2308 reverse primer for updated AMOS eri primer for updated AMOS eri forward primer for updated AMOS eri reverse primer for updated AMOS primer for single step PCR forward primer for single step PCR reverse primer for single step PCR wboA gene primer for B. abortus vaccine RB51 wboA gene forward primer for B. abortus vaccine RB51 wboA gene reverse primer for B. abortus vaccine RB51 wboA gene with part of IS711 primer for B.abortus vaccine RB51 wboA gene with part of IS711 forward primer for B.abortus vaccine RB51 wboA gene with part of IS711 reverse primer for B.abortus vaccine RB51 omp-2 primer omp-2 forward primer omp-2 reverse primer patient derived specimen YL specimen that derives from a patient amplification product of brucellosis PCR assay YL a PCR product that is the output of the PCR assay used in diagnosing brucellosis brucellosis diagnosis by microscopy brucellosis diagnosis made base on the observation from microscopy YL,YH brucellosis diagnosis by immunoassay test YH brucellosis diagnosis made base on the positive result of immunoassay test brucellosis diagnosis by Coombs test brucellosis diagnosis made base on the positive result of Coombs test YL,YH brucellosis diagnosis by complement fixation test YL,YH brucellosis diagnosis made base on the positive result of complement fixation test brucellosis diagnosis by competitive ELISA YL,YH brucellosis diagnosis made base on the positive result of competitive ELISA brucellosis diagnosis by radial immunodiffusion test YL,YH brucellosis diagnosis made base on the radia immunodiffusion test brucellosis diagnosis by counter immunoelectrophoresis brucellosis diagnosis made base on the counter immunoelectrophoresis YL,YH brucellosis diagnosis by Milk Ring Test YL,YH brucellosis diagnosis made base on the positive result of Milk Ring Test brucellosis diagnosis by Brucellacapt brucellosis diagnosis made base on the positive result of Brucellacapt YH,YL brucellosis diagnosis by Serum Agglutination Test (SAT) YL,YH brucellosis diagnosis made base on the positive result of Serum Agglutination Test brucellosis diagnosis by Rose Bengal Test (RB) YL,YH brucellosis diagnosis made base on the positive result of Rose Bengal Test brucellosis diagnosis by 2-Mercapto-ethanol Test (2-ME) YH,YL brucellosis diagnosis made base on the positive result of 2-Mercapto-ethanol Test brucellosis diagnosis by Skin Delayed-Type Hypersensitivity Test (SDTH) YL,YH brucellosis diagnosis made base on the positive result of Skin Delayed-Type Hypersensitivity Test brucellosis diagnosis by Dipstick Assay YL,YH brucellosis diagnosis made base on the positive result of Dipstick Assay brucellosis diagnosis using PCR assay for detecting Brucella omp-2 brucellosis diagnosis made based on the PCR assay that is detecting the Brucella omp-2 gene. YL All the sequence data of primers and PCR product are parts of the genome sequence data from either B. abortus or B. melitensis, suggesting that the test can detect both of these species {Leal-Klevezas, 1995}. Brucella life course YL the life course that has Brucella as participant clinical manifestation of brucellosis a clinical manifestation of brucellosis. YL, YH preclinical manifestation of brucellosis a preclinical manifestation of brucellosis. YL, YH Brucella infected organism brucellosis patient specimen Brucella infected homo sapiens Brucella infected human Brucella infected cow Brucella infected cattle Brucella infected swine brucella infected horse Brucella infected sheep coombs test for human brucellosis YL, YH PubMed: 11060059 PubMed: 9684294 The Coombs Test is a diagonostic test using manufactured antigen and antiglobulins to detect the presence of specific antibodies. It is used very commonly in the detection of human brucellosis, but due to expense and time factors is used less often to detect animal brucellosis. complement fixation test for cattle brucellosis YL, YH PubMed: 9684294 The complement fixation test (CFT), used to diagnose brucellosis in cattle, detects specific IgM and IgG1 antibodies. competitive ELISA for brucellosis YL, YH Competitive ELISA detects serum antibody and is able to distinguish between vaccine and infection derived antibodies. ELISA is used for detection of brucellosis in humans, cattle, sheep and goats. PubMed: 10488186 PubMed: 8051240 radial immunodiffusion test for sheep brucellosis YL, YH A radial immunodiffusion (RID) test uses manufactured Brucella antigens in a gelling agent with wells for goat serum. Sera positive for antibodies to Brucella will diffuse into the gelling agent and cause a visible color change. PubMed: 8051240 RID counter immunoelectrophoresis for sheep brucellosis YL, YH Counter immunoelectrophoresis (CIEP) is used to detect brucellosis in goats. Manufactured antigen binds with antibodies present in sera and the combination is electrophoresed to analyze antibody titers. PubMed: 8051240 brucellosis sign a symptom that is observed by a clinician. YH, YL, ZX sterility a symptom that is observed by a brucellosis patient. YH, YL, ZX brucellosis disposition Brucellosis disposition that is the disposition to be transmitted from an infected, non-human host to a human host. YL brucellosis diagnosis YH, YL, ZX a diagnosis for brucellosis PCR assay for detecting B. abortus vaccine RB51 Brucella abortus vaccine strain RB51 is a natural stable attenuated rough mutant derived from the virulent strain 2308. The genetic mutations that are responsible for the roughness and the attenuation of strain RB51 have not been identified until now. It was demonstrated that the wboA gene encoding a glycosyltransferase, an enzyme essential for the synthesis of O antigen, is disrupted by an IS711 element in B. abortus vaccine strain RB51. The PCR assay developed here can distinguish strain RB51 from all other Brucella species and strains tested. YH, YL, ZX a brucellosis diagnosis that detects the presence of B. abortus vaccine RB51. PCR assay for detecting B. abortus 16S rRNA PubMed: 7538508 a PCR assay for brucellosis that is designed to detect Brucella 16S rRNA. YH, YL, ZX This is a PCR assay with primers derived from the 16S rRNA sequence of Brucella abortus. The pair of primers chosen amplified a 905bp fragment. As little as 80 fg of Brucella DNA was detected by this method. DNAs from all of the representative strains of the species and biovars of Brucella and from 23 different Brucella isolates were analyzed and yielded exclusively the 905-bp fragment. No amplification was detected with DNAs from 10 strains phylogenetically related to Brucella spp., 5 gram-negative bacteria showing serological cross-reactions with Brucella spp., and 36 different clinical isolates of non-Brucella species. Only Ochrobactrum anthropi biotype D yielded a PCR product of 905 bp, suggesting a closer relationship between Brucella spp. and O. anthropi biotype D. The specificity and high sensitivity of the PCR assay may provide a valuable tool for the diagnosis of brucellosis. PCR to amplify 193bp region located in Brucella omp-2 gene PubMed: 8586678 YH, YL, ZX A versatile method for the extraction of Brucella DNA and PCR are presented as reliable tools for the detection of Brucella spp. from body fluids of infected animals. Two oligonucleotides homologous to regions of the gene encoding for an outer membrane protein (OMP-2) were designed to detect the pathogen from milk and/or blood of infected goats, bovine, and human patients. The sensitivity of our test and its ability to detect the pathogen in samples from the field reveal a promising advance in the diagnosis of brucellosis in animals and humans. a PCR assay that has an objective of amplying the 193 bp's region located in Brucella omp-2 gene. AMOS PMID: 7852552 YH, YL, ZX a PCR test for brucellosis that is called AMOS. PubMed: 7852552 Several PCR assays which identify the genus Brucella but do not discriminate among species have been reported. We describe a PCR assay that comprises five oligonucleotide primers which can identify selected biovars of four species of Brucella. Individual biovars within a species are not differentiated. The assay can identify three biovars (1, 2, and 4) of B. abortus, all three biovars of B. melitensis, biovar 1 of B. suis, and all B. ovis biovars. These biovars include all of the Brucella species typically isolated from cattle in the United States, a goal of the present research. The assay exploits the polymorphism arising from species-specific localization of the genetic element IS711 in the Brucella chromosome. Identity is determined by the size(s) of the product(s) amplified from primers hybridizing at various distances from the element. The performance of the assay with U.S. field isolates was highly effective. When 107 field isolates were screened by the described method, there was 100% agreement with the identifications made by conventional methods. Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and Rhodospirillum rubrum) and two control bacteria (Bordetella bronchiseptica and Escherichia coli) tested negative by the assay. updated AMOS YH, YL, ZX Distinguishing vaccine strains from strains that cause infections among vaccinated herds in the field is essential. To accomplish this, the PCR-based, species-specific AMOS assay (B. J. Bricker and S. M. Halling, J. Clin. Microbiol. 32:26602666, 1994) was updated to identify Brucella abortus vaccine strains S19 and RB51. Three new oligonucleotide primers were added to the five-primer multiplex Brucella AMOS PCR assay. Identification is based on the number and sizes of six products amplified by PCR. PMID: 7650203 a PCR test for brucellosis that is composed of updated AMOS. PubMed: 7650203 brucellosis treatment a treatment for brucellosis. YH, YL, ZX a treatment that has an objective to reduce the sign and symptom in brucellosis WHO recommended brucellosis treatment KEY POINTS ON TREATMENT OF BRUCELLOSIS IN HUMANS The essential element in the treatment of all forms of human brucellosis is the administration of effective antibiotics for an adequate length of time. Treatment of uncomplicated cases in adults and children eight years of age and older: doxycycline 100 mg twice a day for six weeks + streptomycin 1 g daily for two to three weeks. OR Doxycycline 100 mg twice a day for six weeks + rifampicin 600-900 mg daily for six weeks. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p41) a brucellosis treatment that was recommended by WHO. YH, YL, ZX rifampin B.abortus RB 51 is resistant to rifampicin. Rifampicin is active in vitro against Brucella species, is remarkably lipid soluble, and it accumulates within eukaryotic cells. In order to provide a completely oral regimen with which to treat brucellosis, the combination of doxycycline (200 mg/day orally) plus rifampicin (60000 mg/day orally), with both drugs administered for six weeks, was recommended by the WHO Expert Committee in 1986. This regimen has generally been found to be of similar efficacy to doxycycline plus streptomycin for patients with uncomplicated brucellosis. Caution is advised when considering this regimen for patients with complications, such as spondylitis. An analysis of various treatment regimens concluded that overall the regimen of doxycycline plus streptomycin was likely to be the most effective. In addition, some data have been reported indicating that rifampicin might enhance the plasma clearance of doxycycline, thus yielding subtherapeutic levels a possible explanation of treatment failures with this regimen. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p37) YH.YL doxycycline Y.L., YH YL antibiotic that is doxycycline Brucella protein A protein synthesized by Brucella spp. ZX, YH, AL Brucella aidB NCBI Gene GI: 1198443; NCBI Protein GI: 17989016; NCBI Protein Accession: NP_541649.1; NCBI Gene GI: 1165038; NCBI Protein GI: 23500342; NCBI Protein Accession: NP_699782.1 ZX, YH, AL Brucella virulence factor disposition A disposition borne by a biological macromolecule produced by Brucella spp. that is the disposition to improve survival of the pathogen in a host, improve transmission of the pathogen to a host, or cause pathological processes in a host. ZX, YH, AL genetic material form OBI's mail. Alan R. proposed this term, and we are waiting for the proval from the community. Y.L.2011/02/16 Brucella protective antigen an antigen that is specifically targeted by the acquired immune response of the host and is able to induce protection in the host against infectious and non-infectious diseases. YH, YL, ZX PMID: 20959289 Brucella protective antigen role Protective antigen role is a role of protective antigen. Protective antigens are specifically targeted by the acquired immune response of the host and are able to induce protection in the host against infectious and non-infectious diseases. PMID: 20959289 YL, YH, ZX Milk Ring Test for Brucella in cow's milk YL, YH MRT PubMed: 9684294 The milk ring test is a serological test for lacteal anti-Brucella IgM and IgA bound to milk fat globules in cow or goat milk. False Positive: False positives may occur with this test in colostrum, milk at the end of a lactation period, or cows suffering from a hormonal disorder or mastitis; however the specificity is reported to be 99%. False Negative: False negatives may occur with this test in milk with a low concentration of lacteal antibodies or lacking fat-clustering factors; the sensitivity is reported to be 56%. PCR primer PCR forward primer PCR reverse primer B. abortus 16S rRNA PCR forward primer Sequence: TCGAGCGCCCGCAAGGGG B. abortus 16S rRNA PCR reverse primer Sequence: AACCATAGTGTCTCCACTAA brucellacapt for human brucellosis YL, YH Brucellacapt is an immunocapture agglutination test for the serodiagnosis of human brucellosis. PubMed: 11060059 PCR forward primer role a primer role that is specifically for the PCR forward primer. YL, YH PCR reverse primer role a primer role that is specifically for the PCR reverse primer. YL, YH Brucella ovis lipopolysaccharide YL,YH YL Brucella lipopolyasccharide that is part of Brucella ovis Brucella contaminated milk producing disposition YL, YH a milk producing disposition that produces Brucella-contaminated milk. Brucella abortus infection diagnosis by PCR test Brucella abortus infection diagnosis made by PCR test method YH,YL YL Brucella melitensis biovar 1 infection diagnosis by PCR test YL,YH diagnosis of brucella melitensis biovar 1 infection made by PCR test Brucella melitensis biovar 2 infection diagnosis by PCR test YL,YH diagnosis of brucella melitensis biovar 2 infection made by PCR test Brucella melitensis infection diagnosis by PCR test diagnosis of brucella melitensis infection made by PCR test YH Brucela melitensis biovar 3 infection diagnosis by PCR test diagnosis of brucella melitensis biovar 3 infection made by PCR test YL,YH Brucella abortus biovar 1 infection diagnosis by PCR test diagnosis of brucella abortus biovar1 infection made by PCR test YL,YH Brucella abortus biovar 2 infection diagnosis by PCR test YL,YH diagnosis of Brucella aborus biovar2 made by PCR test Brucella abortus biovar 3 infection diagnosis by PCR test YL,YH diagnosis of Brucella abortus biovar3 infection made by PCR test Brucella abortus biovar 4 infection diagnosis by PCR test diagnosis of brucella abortus biovar 4 infection made by PCR test YL,YH Brucella abortus biovar 5 infection diagnosis by PCR test diagnosis of brucella abortus biovar 5 infection made by PCR test YL,YH Brucella abortus biovar 6 infection diagnosis by PCR test diagnosis of brucella abortus biovar 6 infection made by PCR test YL,YH Brucella abortus biovar 7 infection diagnosis by PCR test YL,YH diagnosis of brucella abortus biovar 7 infection made by PCR test Brucella abortus biovar 9 infection diagnosis by PCR test diagnosis of brucella abortus biovar 9 infection made by PCR test Brucella suis infection diagnosis by PCR test YL,YH diagnosis of brucella suis infection made by PCR test Brucella suis biovar 1 infection diagnosis by PCR test YL,YH diagnosis of brucella suis biovar 1 infection made by PCR test Brucella suis biovar 2 infection diagnosis by PCR test diagnosis of brucella suis biovar 2 infection made by PCR test YL,YH Brucella suis biovar 3 infection diagnosis by PCR test YL,YH diagnosis of brucella suis biovar 3 infection made by PCR test Brucella suis biovar 4 infection diagnosis by PCR test YL,YH diagnosis of brucella suis biovar 4 infection made by PCR test Brucella suis biovar 5 infection diagnosis by PCR test YL,YH diagnosis of brucella suis biovar 5 infection made by PCR test PCR assay for brucellosis YL laboratory test for brucellosis that uses PCR method laboratory test for brucellosis YL laboratory test that is used for testing brucella infection Brucella infection test by culturing YL the process of testing brucella infection by culturing the specimen derived from patient. Immunoassay test for brucellosis YL laboratory test for testing brucella infection by using immuoassay letter string DNA Sequences from Below: A Nominalist Approach -Yu Lin & Peter Simons (http://sites.google.com/site/petermsimons/peter-s-files/DNASequencesfromBelow.pdf) YL We say W is a string of its elements E iff (Def.) there is a relation defined on the elements E which is connected, asymmetric, bi-directionally unique or non-splitting, and has exactly two free ends. Here we limit the element as "letter", which denotes the information entity of writing. DNA sequence data will be replaced by OBI term Y.L.,YH,ZX genome YL,YH A genome is a part of a organism that 1) is the total set of different DNA molecules of an organelle, cell or organism.2) consists DNA molecules. (The human genome consists of 25 different DNA molecules: the mitochondrial DNA molecule plus the 24 different chromosomal DNA molecules.) Genome,Gene,Interval and Ontology by Yu Lin and Norihiro Sakamoto; published in 'Interdisciplinary Ontology', 2009 "http://cdb-riken.academia.edu/LinYu/Papers/142399/Genome_Gene_Interval_and_Ontology YL In modern molecular biology and genetics, the genome is the entirety of an organism's hereditary information. It is encoded either in DNA or, for many types of virus, in RNA. The genome includes both the genes and the non-coding sequences of the DNA/RNA.(http://en.wikipedia.org/wiki/Genome) DNA primer sequence data DNA sequence data of primer that is used in PCR. Y.L.,YH,ZX serum agglutination test for human and bovine brucellosis YL, YH PubMed: 11060059 PubMed: 9684294 SAT The Serum agglutination test (SAT) is used commonly in the detection of both human and bovine Brucella specific antibodies. rose bengal test for bovine brucellosis PubMed: 8051240 YL, YH PubMed: 9684294 RB test The RB test is a spot agglutination technique that uses dyed B. abortus antigen to detect serum antibodies of bovine brucellosis. 2-Mercapto-ethanol Test for cattle brucellosis 2-ME 2ME PubMed: 9684294 The 2ME test is usually used in serial testing to distinguish between vaccinated and infected cattle. YL a immunoassay test for brucellosis that uses 2-Mercapto-ethanol differentiates between IgM and IgG antibodies and used to identify a recent immune response to an infectious agent. (http://medical-dictionary.thefreedictionary.com/2-mercaptoethanol+(2+ME)+test) skin delayed-type hypersensitivity test for brucellosis PubMed: 10952440 SDTH YL, YH The SDTH test uses manufactured brucellin to elicit a skin hypersensitivity in livestock infected with acute, chronic, or latent brucellosis. dipstick assay for acute human brucellosis A dipstick assay for rapid detection of Brucella specific immunoglobulin uses manufactured Brucella antigen on a nitrocellulose strip. When incubated for three hours with a serum sample, positive samples will form a distinct line, which can be graded from 1-4. YL, YH PubMed: 10565959 brucellosis patient derived blood specimen YL brucellosis patient specimen that is from blood 'temporal distribution' Veterinary epidemiology, Michael Thrusfield. Wiley-Blackwell, 2007. pp 144 S.Ali Temporal distribution is the description of the occurence of the disease over time. The temporal changes and fluctuations in disease occurence can be classified into three major trends: Short term (typically epidemics), Cyclic (including seasonal which are regular periodic fluctuations in disease occurence), and Long term (Secular). tetracycline YH,YL Tetracycline (500 mg every six hours orally) administered for at least six weeks has long been the standard treatment of human brucellosis. Doxycycline (a long acting tetracycline analogue) is now the preferred drug because it can be given once or twice daily, and is associated with fewer gastrointestinal side effects than tetracycline. Doxycycline is given in a dose of 100 mg every 12 hours orally and is administered for a period of six weeks. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p36) intentional release YL a planned process that has an objective of releasing biological agent, usualy has bioterrorism agent as participant. Brucella intentional release Brucella can be used for bioterrorism. Intentional release is a process that intentionally release Brucella to the environment for bioterrorism purpose. Brucella organisms could be released in aerosol form, by accidental spills of culture suspensions or live vaccines, or in liquids such as dairy products or water. Brucellosis has fairly low fatality rate, but could be used as an incapacitating agent, as the disease tends to be chronic, requiring prolonged treatment. We need to model the following: # Emergency Contact: Local health departments and local law enforcement agencies should be contacted in the event of accidental or intentional release of Brucella species(Website 3). # Delivery Mechanism: Brucella organisms could be aerosolized and released at infectious doses. 10-500 organisms in aerosol form constitute an infectious dose. # Containment: Most commercial disinfectants are effective at killing or neutralizing Brucella organisms. Reference: http://www.phidias.us/phinfo/topicSearchResult.php?showall=1&pathogenID[]=3#section_biosafty YL YL,YH intentional release process that has an objective of release aerosolized Brucella. accidental release accidentally release an disease agent or biohazard agent that is not intended. YL Brucella accidental release Accidentally release process of brucella YL pasteurization A planned process of heating a liquid entity, to a specific temperature of a defined length of time span, and then cooling it immediately. It has an objective of prevent the microbial's growth in the liquid entity, which is a specific input of this planned process. Pasteurization is a process of heating a food, usually liquid, to a specific temperature for a definite length of time, and then cooling it immediately. This process slows microbial growth in food. (http://en.wikipedia.org/wiki/Pasteurization) YL pasteurization of dairy product YL pasteurization process has dairy product as input pasteurization of dairy product potentially containing Brucella YH YL dairy product pasteurization that has objective of preventing brcuella's growth, with an input of the dairy product that potentially contains Brucella. milk pasteurization YL pasteurization process has milk as input pasteurization of milk potentially containing Brucella YL milk pasteurization that has objective of preventing brcuella's growth, with an input of the milk that potentially contains Brucella. eradication of infectious disease Eradication is the reduction of an infectious disease's prevalence in the global host population to zero.[1] It is sometimes confused with elimination, which describes either the reduction of an infectious disease's prevalence in a regional population to zero, or the reduction of the global prevalence to a negligible amount. Further confusion arises from the use of the term eradication to refer to the total removal of a given pathogen from an individual (also known as clearance of an infection), particularly in the context of HIV and certain other viruses where such cures are sought. (http://en.wikipedia.org/wiki/Eradication_of_infectious_diseases) YH a process that has an objective to reduce the epidemic of infectious disease brucellosis eradication YH process of eradication that has a objective specification of reduce brucellosis epidemic eradication of non-human brucellosis YH PubMed: 8562733 * Description: Eradication of domestic animals infected with brucellosis, * Efficacy: o Rate: 100% eradication leads to dramatic decreased chance of transmission of brucellosis to humans. o Duration: Duration of efficacy equals duration of effective eradication. * Contraindicator: No contraindicators known, * Complication: False positives and negatives complicate diagnosis of domestic animals and wild animal reservoirs may not be available for testing. Importation of infected animals would renew population prevalence, brucellosis eradication that has objective of reducing non-human brucellosis antibiotic brucellosis treatment YL brucellosis treatment that uses antibotic aminoglycoside Because the rate of relapse when tetracycline or doxycycline are given alone remains between 100%, most authorities recommend an amino-glycoside to be given in addition to the tetracyclines for the first two to three weeks of therapy. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p37) YH, YL streptomycin Streptomycin (1 g/day intramuscularly) administered for two to three weeks has long been the aminoglycoside of choice when used in combination with tetracycline or doxycycline. Although synergy between the two drugs is difficult to prove using routine in vitro assays, bacterial killing studies have shown that Brucella species undergo a more rapid rate of killing by the combination than by either drug alone. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p37) gentamicin Gentamicin is more active in vitro against Brucella species than streptomycin and, when administered as a single daily dose, is associated with few adverse side-effects. Although gentamicin, in a dose of 5mg/kg/day intravenously or intramuscularly, administered for 7 to 10 days in combination with doxycycline administered for six weeks, yielded good results in one study, experience with this regimen is too limited to justify its use over doxycycline plus streptomycin. Unfortunately, no direct study comparing the results of doxycycline plus streptomycin versus doxycycline plus gentamicin has yet been published. Until additional experience is gained using gentamicin in place of streptomycin, the optimal dose and duration of therapy remain unknown. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p37) YH,YL WHO standard treatment for human brucellosis specification fluoroquinolone Fluoroquinolone antibiotics have greater activity in vitro against Brucella species than the parent drug nalidixic acid. In addition, they are well absorbed after oral administration, and they achieve high concentrations within phagocytic cells. Although the minimum bactericidal concentration of quinolones is reported to be approximately four times the minimum inhibitory concentration, a lack of bactericidal activity was found at pH levels comparable to those found within cells. In addition, when quinolones were used as monotherapy in experimental animals and humans infected with Brucella, the rates of relapse were unacceptably high. Therefore, quinolones should always be used in combination with other drugs, such as doxycycline or rifampicin. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p38) YH,YL trimethoprim/sulfamethoxazole YH, YL TMP/SMZ TMP/SMZ in a fixed ratio of 1:5 (80 mg TMP/400 mg SMZ) is more active in vitro against Brucella species than either drug alone. Although initial studies with TMP/ SMZ reported good results, prospective, controlled, comparative trials demonstrated that the drug was associated with an unacceptably high rate of relapse. Consequently, TMP/SMZ should always be used in combination with another agent, such as doxycycline, rifampicin or streptomycin. (http://www.who.int/csr/resources/publications/Brucellosis.pdf p38) co-trimoxazole WHO standard treatment for human brucellosis in adults and children eight years of age and older Treatment of uncomplicated cases in adults and children eight years of age and older: doxycycline 100 mg twice a day for six weeks + streptomycin 1 g daily for two to three weeks. WHO standard treatment for non-humanl brucellosis YH,YL YL a WHO brucellosis treatment that is for non-human brucellosis WHO principal alternative therapy for human brucellosis WHO recommended human brucellosis treatment YL a WHO brucellosis treatment that is for human brucellosis WHO secondary alternative therapy for human brucellosis WHO recommended treatment of human brucellosis during pregnancy WHO recommended treatment of brucellosis in children less than eight years of age Brucella infected goat Brucella infection Almost all domestic species can be affected with brucellosis except cats which are resistant to Brucella infection. Ref: EPIDEMIOLOGY AND EPIZOOTOLOGY OF BRUCELLOSIS: A REVIEW pvj.com.pk/pdf-files/27_3/page%20145-151.pdf YH,Y.L. YL an infection that has part Brucella Brucella abortus infection Brucella melitensis infection Brucella suis infection Brucella canis infection brucellosis disease course a disease course that is realized by burcella infection human brucellosis disease course YL the brucellosis disease course happened in a human Brucella alkA NCBI Gene GI: 1196093; NCBI Protein GI: 17986665; NCBI Protein Accession: NP_539299.1; NCBI Gene GI: 1167338; NCBI Protein GI: 23502506; NCBI Protein Accession: NP_698633.1 ZX, YH, AL Brucella amiC NCBI Gene GI: 1196767; NCBI Protein GI: 17987339; NCBI Protein Accession: NP_539973.1; NCBI Gene GI: 1166584; NCBI Protein GI: 23501801; NCBI Protein Accession: NP_697928.1 ZX, YH, AL Brucella ansC ZX, YH, AL NCBI Gene GI: 1196068; NCBI Protein GI: 17986640; NCBI Protein Accession: NP_539274.1; NCBI Gene GI: 1167369; NCBI Protein GI: 23502534; NCBI Protein Accession: NP_698661.1 Brucella araG ZX, YH, AL NCBI Gene GI: 1198133; NCBI Protein GI: 17988706; NCBI Protein Accession: NP_541339.1; NCBI Gene GI: 1165380; NCBI Protein GI: 23500663; NCBI Protein Accession: NP_700103.1 Brucella aroC NCBI Gene GI: 1197217; NCBI Protein GI: 17987789; NCBI Protein Accession: NP_540423.1; NCBI Gene GI: 3788622; NCBI Protein GI: 82699340; NCBI Protein Accession: YP_413914.1; NCBI Gene GI: 1166089; NCBI Protein GI: 23501329; NCBI Protein Accession: NP_697456.1 Chorismate synthase ZX, YH, AL Brucella arsR6 ZX, YH, AL NCBI Gene GI: 1196141; NCBI Protein GI: 17986713; NCBI Protein Accession: NP_539347.1 Brucella artI NCBI Gene GI: 1196815; NCBI Protein GI: 17987387; NCBI Protein Accession: NP_540021.1; NCBI Gene GI: 1166625; NCBI Protein GI: 23501838; NCBI Protein Accession: NP_697965.1 ZX, YH, AL Brucella aspB ZX, YH, AL NCBI Gene GI: 1196337; NCBI Protein GI: 17986909; NCBI Protein Accession: NP_539543.1; NCBI Gene GI: 1167060; NCBI Protein GI: 23502249; NCBI Protein Accession: NP_698376.1 Brucella aspC NCBI Gene GI: 1196227; NCBI Protein GI: 17986799; NCBI Protein Accession: NP_539433.1; NCBI Gene GI: 3788626; NCBI Protein GI: 82700306; NCBI Protein Accession: YP_414880.1; NCBI Gene GI: 1167178; NCBI Protein GI: 23502364; NCBI Protein Accession: NP_698491.1 ZX, YH, AL Brucella bacA ZX, YH, AL NCBI Gene GI: 1197264; NCBI Protein GI: 17987836; NCBI Protein Accession: NP_540470.1; NCBI Gene GI: 3788635; NCBI Protein GI: 82699288; NCBI Protein Accession: YP_413862.1; NCBI Gene GI: 1166033; NCBI Protein GI: 23501276; NCBI Protein Accession: NP_697403.1 Brucella bicA NCBI Gene GI: 1196316; NCBI Protein GI: 17986888; NCBI Protein Accession: NP_539522.1 ZX, YH, AL hypothetical protein BMEI0085 ZX, YH, AL NCBI Gene GI: 1195797; NCBI Protein GI: 17986369; NCBI Protein Accession: NP_539003.1 Brucella glutathione S-transferase ZX, YH, AL NCBI Gene GI: 1196166; NCBI Protein GI: 17986738; NCBI Protein Accession: NP_539372.1 integral membrane protein / hemolysin [Brucella melitensis bv. 1 str. 16M] NCBI Gene GI: 1196382; NCBI Protein GI: 17986954; NCBI Protein Accession: NP_539588.1 ZX, YH, AL exonuclease [Brucella melitensis bv. 1 str. 16M] ZX, YH, AL NCBI Gene GI: 1196940; NCBI Protein GI: 17987512; NCBI Protein Accession: NP_540146.1 ABC transporter ATP-binding protein [Brucella melitensis bv. 1 str. 16M] NCBI Gene GI: 1196969; NCBI Protein GI: 17987541; NCBI Protein Accession: NP_540175.1 ZX, YH, AL hypothetical protein BMEI1339 [Brucella melitensis bv. 1 str. 16M] NCBI Gene GI: 1197050; NCBI Protein GI: 17987622; NCBI Protein Accession: NP_540256.1 ZX, YH, AL BMEI1361 ZX, YH, AL NCBI Gene GI: 1197072; NCBI Protein GI: 17987644; NCBI Protein Accession: NP_540278.1 BMEI1443 ZX, YH, AL NCBI Gene GI: 1197154; NCBI Protein GI: 17987726; NCBI Protein Accession: NP_540360.1 BMEI1448 ZX, YH, AL NCBI Gene GI: 1197159; NCBI Protein GI: 17987731; NCBI Protein Accession: NP_540365.1 BMEI1531 ZX, YH, AL NCBI Gene GI: 1197242; NCBI Protein GI: 17987814; NCBI Protein Accession: NP_540448.1 BMEI1658 ZX, YH, AL NCBI Gene GI: 1197369; NCBI Protein GI: 17987941; NCBI Protein Accession: NP_540575.1 BMEI1809 NCBI Gene GI: 1197520; NCBI Protein GI: 17988092; NCBI Protein Accession: NP_540726.1 ZX, YH, AL BMEI1844 ZX, YH, AL NCBI Gene GI: 1197555; NCBI Protein GI: 17988127; NCBI Protein Accession: NP_540761.1 BMEI1859 NCBI Gene GI: 1197570; NCBI Protein GI: 17988142; NCBI Protein Accession: NP_540776.1 ZX, YH, AL BMEI1879 NCBI Gene GI: 1197590; NCBI Protein GI: 17988162; NCBI Protein Accession: NP_540796.1 ZX, YH, AL BMEI1902 NCBI Gene GI: 1197613; NCBI Protein GI: 17988185; NCBI Protein Accession: NP_540819.1 ZX, YH, AL BMEII0128 NCBI Gene GI: 1197899; NCBI Protein GI: 17988472; NCBI Protein Accession: NP_541105.1 ZX, YH, AL BMEII0274 NCBI Gene GI: 1198045; NCBI Protein GI: 17988618; NCBI Protein Accession: NP_541251.1 ZX, YH, AL BMEII0318 NCBI Gene GI: 1198090; NCBI Protein GI: 17988663; NCBI Protein Accession: NP_541296.1 ZX, YH, AL BMEII0336 NCBI Gene GI: 1198108; NCBI Protein GI: 17988681; NCBI Protein Accession: NP_541314.1 ZX, YH, AL BMEII0626 NCBI Gene GI: 1198398; NCBI Protein GI: 17988971; NCBI Protein Accession: NP_541604.1 ZX, YH, AL BMEII0923 ZX, YH, AL NCBI Gene GI: 1198695; NCBI Protein GI: 17989268; NCBI Protein Accession: NP_541901.1 BMEII0935 NCBI Gene GI: 1198707; NCBI Protein GI: 17989280; NCBI Protein Accession: NP_541913.1 ZX, YH, AL BMEII1037 NCBI Gene GI: 1198809; NCBI Protein GI: 17989382; NCBI Protein Accession: NP_542015.1 ZX, YH, AL BMEII1045 NCBI Gene GI: 1198817; NCBI Protein GI: 17989390; NCBI Protein Accession: NP_542023.1 ZX, YH, AL Brucella bvrR NCBI Gene GI: 1197747; NCBI Protein GI: 17988319; NCBI Protein Accession: NP_540953.1; NCBI Gene GI: 1167793; NCBI Protein GI: 23502938; NCBI Protein Accession: NP_699065.1 ZX, YH, AL Brucella bvrS NCBI Gene GI: 1197746; NCBI Protein GI: 17988318; NCBI Protein Accession: NP_540952.1; NCBI Gene GI: 1167794; NCBI Protein GI: 23502939; NCBI Protein Accession: NP_699066.1 ZX, YH, AL Brucella caiB ZX, YH, AL NCBI Gene GI: 1196609; NCBI Protein GI: 17987181; NCBI Protein Accession: NP_539815.1; NCBI Gene GI: 1196730; NCBI Protein GI: 17987302; NCBI Protein Accession: NP_539936.1; NCBI Gene GI: 1164661; NCBI Protein GI: 23499983; NCBI Protein Accession: NP_699423.1; NCBI Gene GI: 1166760; NCBI Protein GI: 23501962; NCBI Protein Accession: NP_698089.1 Brucella carAB ZX, YH, AL NCBI Gene GI: 1196237; NCBI Protein GI: 17986809; NCBI Protein Accession: NP_539443.1 Brucella cbbE NCBI Gene GI: 1196827; NCBI Protein GI: 17987399; NCBI Protein Accession: NP_540033.1 ZX, YH, AL Brucella cobB NCBI Gene GI: 1196416; NCBI Protein GI: 17986988; NCBI Protein Accession: NP_539622.1; NCBI Gene GI: 1166977; NCBI Protein GI: 23502172; NCBI Protein Accession: NP_698299.1 ZX, YH, AL Brucella cobW ZX, YH, AL NCBI Gene GI: 1198080; NCBI Protein GI: 17988653; NCBI Protein Accession: NP_541286.1; NCBI Gene GI: 1165431; NCBI Protein GI: 23500711; NCBI Protein Accession: NP_700151.1 Brucella cydB NCBI Gene GI: 1198531; NCBI Protein GI: 17989104; NCBI Protein Accession: NP_541737.1; NCBI Gene GI: 3828142; NCBI Protein GI: 83269608; NCBI Protein Accession: YP_418899.1; NCBI Gene GI: 1164949; NCBI Protein GI: 23500258; NCBI Protein Accession: NP_699698.1 ZX, YH, AL Brucella cydC ZX, YH, AL NCBI Gene GI: 1198533; NCBI Protein GI: 17989106; NCBI Protein Accession: NP_541739.1; NCBI Gene GI: 1164947; NCBI Protein GI: 23500256; NCBI Protein Accession: NP_699696.1 Brucella cydD ZX, YH, AL NCBI Gene GI: 1198534; NCBI Protein GI: 17989107; NCBI Protein Accession: NP_541740.1; NCBI Gene GI: 1164946; NCBI Protein GI: 23500255; NCBI Protein Accession: NP_699695.1 Brucella cysI ZX, YH, AL NCBI Gene GI: 1197477; NCBI Protein GI: 17988049; NCBI Protein Accession: NP_540683.1; NCBI Gene GI: 3788677; NCBI Protein GI: 82699095; NCBI Protein Accession: YP_413669.1; NCBI Gene GI: 1165838; NCBI Protein GI: 23501092; NCBI Protein Accession: NP_697219.1 Brucella cysK ZX, YH, AL NCBI Gene GI: 1196644; NCBI Protein GI: 17987216; NCBI Protein Accession: NP_539850.1; NCBI Gene GI: 1166727; NCBI Protein GI: 23501931; NCBI Protein Accession: NP_698058.1; NCBI Gene GI: 1167668 Brucella cysY ZX, YH, AL NCBI Gene GI: 1197560; NCBI Protein GI: 17988132; NCBI Protein Accession: NP_540766.1 Brucella dacF ZX, YH, AL NCBI Gene GI: 1198122; NCBI Protein GI: 17988695; NCBI Protein Accession: NP_541328.1; NCBI Gene GI: 1165391; NCBI Protein GI: 23500673; NCBI Protein Accession: NP_700113.1 Brucella dbsA NCBI Gene GI: 1198072; NCBI Protein GI: 17988645; NCBI Protein Accession: NP_541278.1 ZX, YH, AL Brucella deoR ZX, YH, AL NCBI Gene GI: 1198865; NCBI Protein GI: 17989438; NCBI Protein Accession: NP_542071.1; NCBI Gene GI: 1164583; NCBI Protein GI: 23499909; NCBI Protein Accession: NP_699349.1 Brucella dhbC ZX, YH, AL NCBI Gene GI: 1197848; NCBI Protein GI: 17988421; NCBI Protein Accession: NP_541054.1 Brucella divK ZX, YH, AL NCBI Gene GI: 1198431; NCBI Protein GI: 17989004; NCBI Protein Accession: NP_541637.1; NCBI Gene GI: 3828149; NCBI Protein GI: 83269512; NCBI Protein Accession: YP_418803.1; NCBI Gene GI: 1165052; NCBI Protein GI: 23500356; NCBI Protein Accession: NP_699796.1 Brucella dnaK NCBI Gene GI: 1197713; NCBI Protein GI: 17988285; NCBI Protein Accession: NP_540919.1; NCBI Gene GI: 1167828; NCBI Protein GI: 23502973; NCBI Protein Accession: NP_699100.1 ebi-goa TO protein folding or response to stress Chaperone protein DnaK ZX, YH, AL Brucella dppA ZX, YH, AL NCBI Gene GI: 1196144; NCBI Protein GI: 17986716; NCBI Protein Accession: NP_539350.1; NCBI Gene GI: 1165456; NCBI Protein GI: 23500735; NCBI Protein Accession: NP_700175.1 Brucella dsbA NCBI Gene GI: 1196751; NCBI Protein GI: 17987323; NCBI Protein Accession: NP_539957.1; NCBI Gene GI: 1196771; NCBI Protein GI: 17987343; NCBI Protein Accession: NP_539977.1; NCBI Gene GI: 1197151; NCBI Protein GI: 17987723; NCBI Protein Accession: NP_540357.1; NCBI Gene GI: 1166157; NCBI Protein GI: 23501397; NCBI Protein Accession: NP_697524.1; NCBI Gene GI: 1166578; NCBI Protein GI: 23501795; NCBI Protein Accession: NP_697922.1; NCBI Gene GI: 1166602; NCBI Protein GI: 23501817; NCBI Protein Accession: NP_697944.1 ZX, YH, AL Brucella dsbB ZX, YH, AL NCBI Gene GI: 1196095; NCBI Protein GI: 17986667; NCBI Protein Accession: NP_539301.1; NCBI Gene GI: 1167334; NCBI Protein GI: 23502502; NCBI Protein Accession: NP_698629.1 Brucella dut ZX, YH, AL NCBI Gene GI: 1196069; NCBI Protein GI: 17986641; NCBI Protein Accession: NP_539275.1; NCBI Gene GI: 3788687; NCBI Protein GI: 82700463; NCBI Protein Accession: YP_415037.1; NCBI Gene GI: 1167368; NCBI Protein GI: 23502533; NCBI Protein Accession: NP_698660.1 Brucella dxps ZX, YH, AL NCBI Gene GI: 1197209; NCBI Protein GI: 17987781; NCBI Protein Accession: NP_540415.1 Brucella eryB ZX, YH, AL NCBI Gene GI: 1198201; NCBI Protein GI: 17988774; NCBI Protein Accession: NP_541407.1; NCBI Gene GI: 1165308; NCBI Protein GI: 23500593; NCBI Protein Accession: NP_700033.1 Brucella EryC NCBI Gene GI: 1198200; NCBI Protein GI: 17988773; NCBI Protein Accession: NP_541406.1; NCBI Gene GI: 1165309; NCBI Protein GI: 23500594; NCBI Protein Accession: NP_700034.1 ZX, YH, AL encoded by eryC gene. Brucella exsA NCBI Gene GI: 1197453; NCBI Protein GI: 17988025; NCBI Protein Accession: NP_540659.1; NCBI Gene GI: 1166103; NCBI Protein GI: 23501343; NCBI Protein Accession: NP_697470.1 ZX, YH, AL Brucella fbpA NCBI Gene GI: 1198356; NCBI Protein GI: 17988929; NCBI Protein Accession: NP_541562.1; NCBI Gene GI: 1165142; NCBI Protein GI: 23500440; NCBI Protein Accession: NP_699880.1 ZX, YH, AL Brucella fdhA ZX, YH, AL NCBI Gene GI: 1198150; NCBI Protein GI: 17988723; NCBI Protein Accession: NP_541356.1; NCBI Gene GI: 1165363; NCBI Protein GI: 23500646; NCBI Protein Accession: NP_700086.1 Brucella feuP NCBI Gene GI: 1197048; NCBI Protein GI: 17987620; NCBI Protein Accession: NP_540254.1; NCBI Gene GI: 1166266; NCBI Protein GI: 23501491; NCBI Protein Accession: NP_697618.1 ZX, YH, AL Brucella feuQ ZX, YH, AL NCBI Gene GI: 1197047; NCBI Protein GI: 17987619; NCBI Protein Accession: NP_540253.1; NCBI Gene GI: 1166267; NCBI Protein GI: 23501492; NCBI Protein Accession: NP_697619.1 Brucella flgE NCBI Gene GI: 1197930; NCBI Protein GI: 17988503; NCBI Protein Accession: NP_541136.1; NCBI Gene GI: 3827409; NCBI Protein GI: 83269934; NCBI Protein Accession: YP_419225.1; NCBI Gene GI: 1165592; NCBI Protein GI: 23500854; NCBI Protein Accession: NP_700294.1 ZX, YH, AL Brucella flghA ZX, YH, AL NCBI Gene GI: 1197937; NCBI Protein GI: 17988510; NCBI Protein Accession: NP_541143.1 Brucella flgI ZX, YH, AL NCBI Gene GI: 1198856; NCBI Protein GI: 17989429; NCBI Protein Accession: NP_542062.1; NCBI Gene GI: 3828215; NCBI Gene GI: 3828216; NCBI Gene GI: 1164593; NCBI Protein GI: 161486704; NCBI Protein Accession: NP_699358.2 Brucella fliC ZX, YH, AL NCBI Gene GI: 1197921; NCBI Protein GI: 17988494; NCBI Protein Accession: NP_541127.1 Brucella fliF NCBI Gene GI: 1197922; NCBI Protein GI: 17988495; NCBI Protein Accession: NP_541128.1; NCBI Gene GI: 3828220; NCBI Protein GI: 83269941; NCBI Protein Accession: YP_419232.1; NCBI Gene GI: 1165599; NCBI Protein GI: 23500860; NCBI Protein Accession: NP_700300.1 ZX, YH, AL Brucella ftcR NCBI Gene GI: 1197929; NCBI Protein GI: 17988502; NCBI Protein Accession: NP_541135.1 ZX, YH, AL Brucella galcD NCBI Gene GI: 1198257; NCBI Protein GI: 17988830; NCBI Protein Accession: NP_541463.1; NCBI Gene GI: 1165248; NCBI Protein GI: 23500539; NCBI Protein Accession: NP_699979.1 ZX, YH, AL Brucella galE NCBI Gene GI: 1196948; NCBI Protein GI: 17987520; NCBI Protein Accession: NP_540154.1; NCBI Gene GI: 1166378; NCBI Protein GI: 23501602; NCBI Protein Accession: NP_697729.1 ZX, YH, AL Brucella gcvP ZX, YH, AL NCBI Gene GI: 3828233; NCBI Protein GI: 83269414; NCBI Protein Accession: YP_418705.1; NCBI Gene GI: 1165167; NCBI Protein GI: 23500462; NCBI Protein Accession: NP_699902.1 Brucella gcvT ZX, YH, AL NCBI Gene GI: 3828234; NCBI Protein GI: 83269412; NCBI Protein Accession: YP_418703.1; NCBI Gene GI: 1165169; NCBI Protein GI: 23500464; NCBI Protein Accession: NP_699904.1 Brucella glnA ZX, YH, AL NCBI Gene GI: 1196690; NCBI Protein GI: 17987262; NCBI Protein Accession: NP_539896.1; NCBI Gene GI: 3788725; NCBI Protein GI: 82699855; NCBI Protein Accession: YP_414429.1; NCBI Gene GI: 1166677; NCBI Protein GI: 23501884; NCBI Protein Accession: NP_698011.1 Brucella glnD NCBI Gene GI: 1197515; NCBI Protein GI: 17988087; NCBI Protein Accession: NP_540721.1; NCBI Gene GI: 1165801; NCBI Protein GI: 23501056; NCBI Protein Accession: NP_697183.1 uridylyltransferase ZX, YH, AL Brucella glnL ZX, YH, AL NCBI Gene GI: 1197497; NCBI Protein GI: 17988069; NCBI Protein Accession: NP_540703.1 Brucella gloA ZX, YH, AL NCBI Gene GI: 1196441; NCBI Protein GI: 17987013; NCBI Protein Accession: NP_539647.1; NCBI Gene GI: 3788728; NCBI Protein GI: 82700098; NCBI Protein Accession: YP_414672.1; NCBI Gene GI: 1166947; NCBI Protein GI: 23502144; NCBI Protein Accession: NP_698271.1 Brucella glpK ZX, YH, AL NCBI Gene GI: 1198595; NCBI Protein GI: 17989168; NCBI Protein Accession: NP_541801.1; NCBI Gene GI: 3828238; NCBI Gene GI: 1164881; NCBI Protein GI: 23500192; NCBI Protein Accession: NP_699632.1 Brucella glt1 NCBI Gene GI: 1197810; NCBI Protein GI: 17988383; NCBI Protein Accession: NP_541016.1 ZX, YH, AL Brucella gltD ZX, YH, AL NCBI Gene GI: 1197811; NCBI Protein GI: 17988384; NCBI Protein Accession: NP_541017.1; NCBI Gene GI: 3828240; NCBI Protein GI: 83269008; NCBI Protein Accession: YP_418299.1; NCBI Gene GI: 1164492; NCBI Protein GI: 23499822; NCBI Protein Accession: NP_699262.1 Brucella gluP NCBI Gene GI: 1198825; NCBI Protein GI: 17989398; NCBI Protein Accession: NP_542031.1; NCBI Gene GI: 1164627 ZX, YH, AL Brucella glyA ZX, YH, AL NCBI Gene GI: 1196903; NCBI Protein GI: 17987475; NCBI Protein Accession: NP_540109.1; NCBI Gene GI: 3788734; NCBI Protein GI: 82699646; NCBI Protein Accession: YP_414220.1; NCBI Gene GI: 1166430; NCBI Protein GI: 23501652; NCBI Protein Accession: NP_697779.1 asserted Participates in process from ftp://ftp.ebi.ac.uk/pub/databases/GO/goa/proteomes/100.B_suis_1.goa Brucella gmd NCBI Gene GI: 3788735; NCBI Protein GI: 82699425; NCBI Protein Accession: YP_413999.1; NCBI Gene GI: 1166184; NCBI Protein GI: 23501417; NCBI Protein Accession: NP_697544.1 ZX, YH, AL Brucella gnd ZX, YH, AL NCBI Gene GI: 1198896; NCBI Protein GI: 17989469; NCBI Protein Accession: NP_542102.1; NCBI Gene GI: 3828241; NCBI Protein GI: 83269060; NCBI Protein Accession: YP_418351.1; NCBI Gene GI: 1164548; NCBI Protein GI: 23499876; NCBI Protein Accession: NP_699316.1 Brucella gntR ZX, YH, AL NCBI Gene GI: 1198838; NCBI Protein GI: 17989411; NCBI Protein Accession: NP_542044.1; NCBI Gene GI: 1164614; NCBI Protein GI: 23499939; NCBI Protein Accession: NP_699379.1 Brucella gntR1 ZX, YH, AL NCBI Gene GI: 1198247; NCBI Protein GI: 17988820; NCBI Protein Accession: NP_541453.1 Brucella gntR10 NCBI Gene GI: 1197887; NCBI Protein GI: 17988460; NCBI Protein Accession: NP_541093.1 ZX, YH, AL Brucella gntR17 NCBI Gene GI: 1196031; NCBI Protein GI: 17986603; NCBI Protein Accession: NP_539237.1 ZX, YH, AL Brucella gntR2 NCBI Gene GI: 1196016; NCBI Protein GI: 17986588; NCBI Protein Accession: NP_539222.1 ZX, YH, AL Brucella gntR4 NCBI Gene GI: 1195881; NCBI Protein GI: 17986453; NCBI Protein Accession: NP_539087.1 ZX, YH, AL Brucella gntR5 ZX, YH, AL NCBI Gene GI: 1196592; NCBI Protein GI: 17987164; NCBI Protein Accession: NP_539798.1 Brucella gtrB ZX, YH, AL NCBI Gene GI: 1198873; NCBI Protein GI: 17989446; NCBI Protein Accession: NP_542079.1; NCBI Gene GI: 1164572; NCBI Protein GI: 23499898; NCBI Protein Accession: NP_699338.1 Brucella hemH Ferrochelatase NCBI Gene GI: 1197789; NCBI Protein GI: 17988362; NCBI Protein Accession: NP_540995.1; NCBI Gene GI: 3828247; NCBI Protein GI: 83269029; NCBI Protein Accession: YP_418320.1; NCBI Gene GI: 1164513; NCBI Protein GI: 23499843; NCBI Protein Accession: NP_699283.1 ZX, YH, AL Brucella hfq ZX, YH, AL NCBI Gene GI: 1196583; NCBI Protein GI: 17987155; NCBI Protein Accession: NP_539789.1; NCBI Gene GI: 3788748; NCBI Protein GI: 82699953; NCBI Protein Accession: YP_414527.1; NCBI Gene GI: 1166787; NCBI Protein GI: 23501989; NCBI Protein Accession: NP_698116.1 Brucella hisC NCBI Gene GI: 3788751; NCBI Protein GI: 82700747; NCBI Protein Accession: YP_415321.1; NCBI Gene GI: 1167688; NCBI Protein GI: 23502835; NCBI Protein Accession: NP_698962.1 ZX, YH, AL Brucella hisD ZX, YH, AL NCBI Gene GI: 1197379; NCBI Protein GI: 17987951; NCBI Protein Accession: NP_540585.1; NCBI Gene GI: 3788752; NCBI Protein GI: 82699185; NCBI Protein Accession: YP_413759.1; NCBI Gene GI: 1165911; NCBI Protein GI: 23501159; NCBI Protein Accession: NP_697286.1 Brucella hisF ZX, YH, AL NCBI Gene GI: 1197752; NCBI Protein GI: 17988324; NCBI Protein Accession: NP_540958.1; NCBI Gene GI: 3788754; NCBI Protein GI: 82700840; NCBI Protein Accession: YP_415414.1; NCBI Gene GI: 1167788; NCBI Protein GI: 23502933; NCBI Protein Accession: NP_699060.1 Brucella hpt ZX, YH, AL NCBI Gene GI: 1195794; NCBI Protein GI: 17986366; NCBI Protein Accession: NP_539000.1; NCBI Gene GI: 3788755; NCBI Protein GI: 82700745; NCBI Protein Accession: YP_415319.1; NCBI Gene GI: 1167686; NCBI Protein GI: 23502833; NCBI Protein Accession: NP_698960.1 Brucella htrA NCBI Gene GI: 1197041; NCBI Protein GI: 17987613; NCBI Protein Accession: NP_540247.1; NCBI Gene GI: 1166273; NCBI Protein GI: 23501498; NCBI Protein Accession: NP_697625.1 Probable periplasmic serine endoprotease DegP-like ZX, YH, AL Brucella ilvC ZX, YH, AL NCBI Gene GI: 1196335; NCBI Protein GI: 17986907; NCBI Protein Accession: NP_539541.1; NCBI Gene GI: 1167062; NCBI Protein GI: 23502251; NCBI Protein Accession: NP_698378.1 Brucella Dihydroxy-acid dehydratase ZX, YH, AL NCBI Gene GI: 1197559; NCBI Protein GI: 17988131; NCBI Protein Accession: NP_540765.1; NCBI Gene GI: 3788763; NCBI Protein GI: 82699018; NCBI Protein Accession: YP_413592.1; NCBI Gene GI: 1165756; NCBI Protein GI: 23501013; NCBI Protein Accession: NP_697140.1 assertion of particpates in... is from EBI-GOA file: ftp://ftp.ebi.ac.uk/pub/databases/GO/goa/proteomes/22482.B_abortus_2308.goa Brucella ilvI ZX, YH, AL NCBI Gene GI: 1196328; NCBI Protein GI: 17986900; NCBI Protein Accession: NP_539534.1 Brucella leuA NCBI Gene GI: 1196162; NCBI Protein GI: 17986734; NCBI Protein Accession: NP_539368.1; NCBI Gene GI: 3788771; NCBI Protein GI: 162002872; NCBI Protein Accession: YP_414947.2; NCBI Gene GI: 1167249; NCBI Protein GI: 161486694; NCBI Protein Accession: NP_698557.2 ZX, YH, AL Brucella leuC ZX, YH, AL NCBI Gene GI: 1195869; NCBI Protein GI: 17986441; NCBI Protein Accession: NP_539075.1; NCBI Gene GI: 3788772; NCBI Protein GI: 82700673; NCBI Protein Accession: YP_415247.1; NCBI Gene GI: 1167606; NCBI Protein GI: 23502757; NCBI Protein Accession: NP_698884.1 Brucella livH ZX, YH, AL NCBI Gene GI: 1195970; NCBI Protein GI: 17986542; NCBI Protein Accession: NP_539176.1; NCBI Gene GI: 1167484; NCBI Protein GI: 23502645; NCBI Protein Accession: NP_698772.1 Brucella lon ZX, YH, AL NCBI Gene GI: 1196587; NCBI Protein GI: 17987159; NCBI Protein Accession: NP_539793.1; NCBI Gene GI: 1166782; NCBI Protein GI: 23501984; NCBI Protein Accession: NP_698111.1 Brucella lpsA ZX, YH, AL NCBI Gene GI: 1197037; NCBI Protein GI: 17987609; NCBI Protein Accession: NP_540243.1; NCBI Gene GI: 1166277; NCBI Protein GI: 23501502; NCBI Protein Accession: NP_697629.1 Brucella lpsB ZX, YH, AL NCBI Gene GI: 1196220; NCBI Protein GI: 17986792; NCBI Protein Accession: NP_539426.1 Brucella lysA ZX, YH, AL NCBI Gene GI: 1195796; NCBI Protein GI: 17986368; NCBI Protein Accession: NP_539002.1; NCBI Gene GI: 3788788; NCBI Protein GI: 82700743; NCBI Protein Accession: YP_415317.1; NCBI Gene GI: 1167684; NCBI Protein GI: 23502831; NCBI Protein Accession: NP_698958.1 Brucella lysR NCBI Gene GI: 1196224; NCBI Protein GI: 17986796; NCBI Protein Accession: NP_539430.1; NCBI Gene GI: 1167181; NCBI Protein GI: 23502367; NCBI Protein Accession: NP_698494.1 ZX, YH, AL Brucella lysR12 NCBI Gene GI: 1198162; NCBI Protein GI: 17988735; NCBI Protein Accession: NP_541368.1 ZX, YH, AL Brucella lysR13 ZX, YH, AL NCBI Gene GI: 1197624; NCBI Protein GI: 17988196; NCBI Protein Accession: NP_540830.1 Brucella lysR18 NCBI Gene GI: 1197284; NCBI Protein GI: 17987856; NCBI Protein Accession: NP_540490.1 ZX, YH, AL Brucella macA ZX, YH, AL NCBI Gene GI: 1196070; NCBI Protein GI: 17986642; NCBI Protein Accession: NP_539276.1; NCBI Gene GI: 1167364; NCBI Protein GI: 23502529; NCBI Protein Accession: NP_698656.1 Brucella malK ZX, YH, AL NCBI Gene GI: 1197424; NCBI Protein GI: 17987996; NCBI Protein Accession: NP_540630.1; NCBI Gene GI: 1165896; NCBI Protein GI: 23501145; NCBI Protein Accession: NP_697272.1 Brucella manB ZX, YH, AL NCBI Gene GI: 1198671; NCBI Protein GI: 17989244; NCBI Protein Accession: NP_541877.1; NCBI Gene GI: 1164786; NCBI Protein GI: 23500101; NCBI Protein Accession: NP_699541.1 Brucella metH NCBI Gene GI: 1197470; NCBI Protein GI: 17988042; NCBI Protein Accession: NP_540676.1; NCBI Gene GI: 3786978; NCBI Protein GI: 82699102; NCBI Protein Accession: YP_413676.1; NCBI Gene GI: 1165845; NCBI Protein GI: 23501099; NCBI Protein Accession: NP_697226.1 ZX, YH, AL Brucella mgps NCBI Gene GI: 1195987; NCBI Protein GI: 17986559; NCBI Protein Accession: NP_539193.1 ZX, YH, AL Brucella mgtB NCBI Gene GI: 1197827; NCBI Protein GI: 17988400; NCBI Protein Accession: NP_541033.1; NCBI Gene GI: 1164473; NCBI Protein GI: 23499804; NCBI Protein Accession: NP_699244.1 ZX, YH, AL Brucella miaA ZX, YH, AL NCBI Gene GI: 1196327; NCBI Protein GI: 17986899; NCBI Protein Accession: NP_539533.1; NCBI Gene GI: 3787973; NCBI Protein GI: 82700207; NCBI Protein Accession: YP_414781.1; NCBI Gene GI: 1167072; NCBI Protein GI: 23502261; NCBI Protein Accession: NP_698388.1 Brucella mocC ZX, YH, AL NCBI Gene GI: 1198342; NCBI Protein GI: 17988915; NCBI Protein Accession: NP_541548.1 Brucella mosC NCBI Gene GI: 1195979; NCBI Protein GI: 17986551; NCBI Protein Accession: NP_539185.1 ZX, YH, AL Brucella motB ZX, YH, AL NCBI Gene GI: 1197925; NCBI Protein GI: 17988498; NCBI Protein Accession: NP_541131.1; NCBI Gene GI: 3827414; NCBI Protein GI: 83269939; NCBI Protein Accession: YP_419230.1; NCBI Gene GI: 1165597; NCBI Protein GI: 23500858; NCBI Protein Accession: NP_700298.1 Brucella mutM NCBI Gene GI: 1197657; NCBI Protein GI: 17988229; NCBI Protein Accession: NP_540863.1; NCBI Gene GI: 1167886; NCBI Protein GI: 23503030; NCBI Protein Accession: NP_699157.1 ZX, YH, AL Brucella narG NCBI Gene GI: 1198722; NCBI Protein GI: 17989295; NCBI Protein Accession: NP_541928.1; NCBI Gene GI: 3827924; NCBI Protein GI: 83269759; NCBI Protein Accession: YP_419050.1; NCBI Gene GI: 1164736; NCBI Protein GI: 23500054; NCBI Protein Accession: NP_699494.1 ZX, YH, AL nitrate reductase function see PMID:12438693 Brucella ndrI NCBI Gene GI: 1198703; NCBI Protein GI: 17989276; NCBI Protein Accession: NP_541909.1 ZX, YH, AL Brucella ndvB NCBI Gene GI: 1197548; NCBI Protein GI: 17988120; NCBI Protein Accession: NP_540754.1; NCBI Gene GI: 1165768; NCBI Protein GI: 23501025; NCBI Protein Accession: NP_697152.1 ZX, YH, AL Brucella nifS NCBI Gene GI: 1196754; NCBI Protein GI: 17987326; NCBI Protein Accession: NP_539960.1; NCBI Gene GI: 1166599; NCBI Protein GI: 23501814; NCBI Protein Accession: NP_697941.1 ZX, YH, AL Brucella nikA ZX, YH, AL NCBI Gene GI: 1198259; NCBI Protein GI: 17988832; NCBI Protein Accession: NP_541465.1; NCBI Gene GI: 1165246; NCBI Protein GI: 23500537; NCBI Protein Accession: NP_699977.1 Brucella nodV ZX, YH, AL NCBI Gene GI: 1197823; NCBI Protein GI: 17988396; NCBI Protein Accession: NP_541029.1; NCBI Gene GI: 1164477; NCBI Protein GI: 23499808; NCBI Protein Accession: NP_699248.1 Brucella norD ZX, YH, AL NCBI Gene GI: 1164688; NCBI Protein GI: 23500008; NCBI Protein Accession: NP_699448.1 Brucella norE ZX, YH, AL NCBI Gene GI: 1198773; NCBI Protein GI: 17989346; NCBI Protein Accession: NP_541979.1; NCBI Gene GI: 1164683; NCBI Protein GI: 23500003; NCBI Protein Accession: NP_699443.1 Brucella nrdH ZX, YH, AL NCBI Gene GI: 1198704; NCBI Protein GI: 17989277; NCBI Protein Accession: NP_541910.1; NCBI Gene GI: 3827703; NCBI Protein GI: 83269752; NCBI Protein Accession: YP_419043.1; NCBI Gene GI: 1164751; NCBI Protein GI: 23500069; NCBI Protein Accession: NP_699509.1 Brucella ntrC NCBI Gene GI: 3788817; NCBI Protein GI: 82699958; NCBI Protein Accession: YP_414532.1; NCBI Gene GI: 1166793; NCBI Protein GI: 23501995; NCBI Protein Accession: NP_698122.1 ZX, YH, AL Brucella ntrY NCBI Gene GI: 1196578; NCBI Protein GI: 17987150; NCBI Protein Accession: NP_539784.1; NCBI Gene GI: 3788818; NCBI Protein GI: 82699957; NCBI Protein Accession: YP_414531.1; NCBI Gene GI: 1166792; NCBI Protein GI: 23501994; NCBI Protein Accession: NP_698121.1 ZX, YH, AL Brucella omp10 ZX, YH, AL NCBI Gene GI: 1197788; NCBI Protein GI: 17988361; NCBI Protein Accession: NP_540994.1; NCBI Gene GI: 3828036; NCBI Protein GI: 83269030; NCBI Protein Accession: YP_418321.1; NCBI Gene GI: 1164514; NCBI Protein GI: 23499844; NCBI Protein Accession: NP_699284.1 Brucella omp19 ZX, YH, AL NCBI Gene GI: 1195847; NCBI Protein GI: 17986419; NCBI Protein Accession: NP_539053.1; NCBI Gene GI: 3788831; NCBI Protein GI: 82700695; NCBI Protein Accession: YP_415269.1; NCBI Gene GI: 1167630; NCBI Protein GI: 23502780; NCBI Protein Accession: NP_698907.1 Brucella omp25 ZX, YH, AL NCBI Gene GI: 1196960; NCBI Protein GI: 17987532; NCBI Protein Accession: NP_540166.1; NCBI Gene GI: 1166364; NCBI Protein GI: 23501588; NCBI Protein Accession: NP_697715.1 Brucella oxyR ZX, YH, AL NCBI Gene GI: 1164792; NCBI Protein GI: 23500107; NCBI Protein Accession: NP_699547.1 Brucella pcs ZX, YH, AL NCBI Gene GI: 1165011; NCBI Protein GI: 23500316; NCBI Protein Accession: NP_699756.1 Brucella pepN ZX, YH, AL NCBI Gene GI: 3788843; NCBI Protein GI: 82699509; NCBI Protein Accession: YP_414083.1; NCBI Gene GI: 1166279; NCBI Protein GI: 23501504; NCBI Protein Accession: NP_697631.1 Brucella perA NCBI Gene GI: 1197125; NCBI Protein GI: 17987697; NCBI Protein Accession: NP_540331.1; NCBI Gene GI: 1166183; NCBI Protein GI: 23501416; NCBI Protein Accession: NP_697543.1 ZX, YH, AL Brucella pgi Glucose-6-phosphate isomerase ZX, YH, AL NCBI Gene GI: 1197347; NCBI Protein GI: 17987919; NCBI Protein Accession: NP_540553.1; NCBI Gene GI: 3787092; NCBI Protein GI: 82699210; NCBI Protein Accession: YP_413784.1; NCBI Gene GI: 1165946; NCBI Protein GI: 23501192; NCBI Protein Accession: NP_697319.1 Brucella pgm ZX, YH, AL NCBI Gene GI: 1197597; NCBI Protein GI: 17988169; NCBI Protein Accession: NP_540803.1; NCBI Gene GI: 3788847; NCBI Protein GI: 82698981; NCBI Protein Accession: YP_413555.1; NCBI Gene GI: 1165715; NCBI Protein GI: 23500973; NCBI Protein Accession: NP_697100.1 Brucella pheA NCBI Gene GI: 3788850; NCBI Protein GI: 82698963; NCBI Protein Accession: YP_413537.1; NCBI Gene GI: 1165694; NCBI Protein GI: 23500952; NCBI Protein Accession: NP_697079.1 ZX, YH, AL Brucella pheB ZX, YH, AL NCBI Gene GI: 1197907; NCBI Protein GI: 17988480; NCBI Protein Accession: NP_541113.1 Brucella pmm ZX, YH, AL NCBI Gene GI: 1197107; NCBI Protein GI: 17987679; NCBI Protein Accession: NP_540313.1; NCBI Gene GI: 1166199; NCBI Protein GI: 23501426; NCBI Protein Accession: NP_697553.1 Brucella pmtA ZX, YH, AL NCBI Gene GI: 1167830; NCBI Protein GI: 23502975; NCBI Protein Accession: NP_699102.1 Brucella pncA NCBI Gene GI: 1196256; NCBI Protein GI: 17986828; NCBI Protein Accession: NP_539462.1; NCBI Gene GI: 1167146; NCBI Protein GI: 23502333; NCBI Protein Accession: NP_698460.1; NCBI Gene GI: 1167147; NCBI Protein GI: 23502334; NCBI Protein Accession: NP_698461.1 ZX, YH, AL Brucella ppiD ZX, YH, AL NCBI Gene GI: 1196556; NCBI Protein GI: 17987128; NCBI Protein Accession: NP_539762.1; NCBI Gene GI: 1166815; NCBI Protein GI: 23502017; NCBI Protein Accession: NP_698144.1 Brucella pstP ZX, YH, AL NCBI Gene GI: 1195902; NCBI Protein GI: 17986474; NCBI Protein Accession: NP_539108.1 Brucella pth NCBI Gene GI: 1196191; NCBI Protein GI: 17986763; NCBI Protein Accession: NP_539397.1; NCBI Gene GI: 3788869; NCBI Protein GI: 82700344; NCBI Protein Accession: YP_414918.1; NCBI Gene GI: 1167219; NCBI Protein GI: 23502404; NCBI Protein Accession: NP_698531.1 ZX, YH, AL Brucella purD NCBI Gene GI: 1197230; NCBI Protein GI: 17987802; NCBI Protein Accession: NP_540436.1; NCBI Gene GI: 3788874; NCBI Protein GI: 82699328; NCBI Protein Accession: YP_413902.1; NCBI Gene GI: 1166075; NCBI Protein GI: 23501317; NCBI Protein Accession: NP_697444.1 ZX, YH, AL Brucella purE NCBI Gene GI: 1196007; NCBI Protein GI: 17986579; NCBI Protein Accession: NP_539213.1; NCBI Gene GI: 1167437; NCBI Protein GI: 23502601; NCBI Protein Accession: NP_698728.1 ZX, YH, AL Brucella purF ZX, YH, AL NCBI Gene GI: 1197199; NCBI Protein GI: 17987771; NCBI Protein Accession: NP_540405.1; NCBI Gene GI: 3788875; NCBI Protein GI: 82699358; NCBI Protein Accession: YP_413932.1; NCBI Gene GI: 1166107; NCBI Protein GI: 23501347; NCBI Protein Accession: NP_697474.1 Brucella purH NCBI Gene GI: 1195945; NCBI Protein GI: 17986517; NCBI Protein Accession: NP_539151.1; NCBI Gene GI: 3788876; NCBI Protein GI: 82700596; NCBI Protein Accession: YP_415170.1; NCBI Gene GI: 1167509; NCBI Protein GI: 23502669; NCBI Protein Accession: NP_698796.1 ZX, YH, AL Brucella purL ZX, YH, AL NCBI Gene GI: 1196838; NCBI Protein GI: 17987410; NCBI Protein Accession: NP_540044.1; NCBI Gene GI: 1166505; NCBI Protein GI: 23501724; NCBI Protein Accession: NP_697851.1 The assertion of participated process comes from EBI-GOA file and PMID: 12761078 Brucella purM NCBI Gene GI: 1196951; NCBI Protein GI: 17987523; NCBI Protein Accession: NP_540157.1; NCBI Gene GI: 3788878; NCBI Protein GI: 82699599; NCBI Protein Accession: YP_414173.1; NCBI Gene GI: 1166373; NCBI Protein GI: 23501597; NCBI Protein Accession: NP_697724.1 ZX, YH, AL Brucella purN NCBI Gene GI: 1196952; NCBI Protein GI: 17987524; NCBI Protein Accession: NP_540158.1; NCBI Gene GI: 3788879; NCBI Protein GI: 162002876; NCBI Protein Accession: YP_414172.2; NCBI Gene GI: 1166372; NCBI Protein GI: 161486698; NCBI Protein Accession: NP_697723.2 ZX, YH, AL Brucella pyc participates assertion see PMID 10678941 NCBI Gene GI: 1195978; NCBI Protein GI: 17986550; NCBI Protein Accession: NP_539184.1; NCBI Gene GI: 3788880; NCBI Protein GI: 82700564; NCBI Protein Accession: YP_415138.1; NCBI Gene GI: 1167474; NCBI Protein GI: 23502636; NCBI Protein Accession: NP_698763.1 ZX, YH, AL Brucella pyrB ZX, YH, AL NCBI Gene GI: 1198442; NCBI Protein GI: 17989015; NCBI Protein Accession: NP_541648.1; NCBI Gene GI: 3827823; NCBI Protein GI: 83269525; NCBI Protein Accession: YP_418816.1; NCBI Gene GI: 1165039; NCBI Protein GI: 23500343; NCBI Protein Accession: NP_699783.1 Brucella pyrC ZX, YH, AL NCBI Gene GI: 1196992; NCBI Protein GI: 17987564; NCBI Protein Accession: NP_540198.1; NCBI Gene GI: 1198441; NCBI Protein GI: 17989014; NCBI Protein Accession: NP_541647.1 Brucella pyrD ZX, YH, AL NCBI Gene GI: 1197322; NCBI Protein GI: 17987894; NCBI Protein Accession: NP_540528.1; NCBI Gene GI: 3788883; NCBI Protein GI: 82699235; NCBI Protein Accession: YP_413809.1; NCBI Gene GI: 1165972; NCBI Protein GI: 23501218; NCBI Protein Accession: NP_697345.1 Brucella rbsC NCBI Gene GI: 1198473; NCBI Protein GI: 17989046; NCBI Protein Accession: NP_541679.1; NCBI Gene GI: 1165007; NCBI Protein GI: 23500312; NCBI Protein Accession: NP_699752.1 ZX, YH, AL Brucella rbsK ZX, YH, AL NCBI Gene GI: 1197860; NCBI Protein GI: 17988433; NCBI Protein Accession: NP_541066.1; NCBI Gene GI: 1164441; NCBI Protein GI: 23499772; NCBI Protein Accession: NP_699212.1 Brucella recA ZX, YH, AL NCBI Gene GI: 1196498; NCBI Protein GI: 17987070; NCBI Protein Accession: NP_539704.1; NCBI Gene GI: 3788897; NCBI Protein GI: 82700036; NCBI Protein Accession: YP_414610.1; NCBI Gene GI: 1166878; NCBI Protein GI: 23502079; NCBI Protein Accession: NP_698206.1 Brucella rfbD ZX, YH, AL NCBI Gene GI: 1197124; NCBI Protein GI: 17987696; NCBI Protein Accession: NP_540330.1; NCBI Gene GI: 3788901; NCBI Protein GI: 82699423; NCBI Protein Accession: YP_413997.1; NCBI Gene GI: 1166182; NCBI Protein GI: 23501415; NCBI Protein Accession: NP_697542.1 Brucella RpiR ZX, YH, AL NCBI Gene GI: 1198345; NCBI Protein GI: 17988918; NCBI Protein Accession: NP_541551.1; NCBI Gene GI: 1165154; NCBI Protein GI: 23500452; NCBI Protein Accession: NP_699892.1 Brucella rplS NCBI Gene GI: 1195868; NCBI Protein GI: 17986440; NCBI Protein Accession: NP_539074.1; NCBI Gene GI: 3788922; NCBI Protein GI: 82700674; NCBI Protein Accession: YP_415248.1; NCBI Gene GI: 1167607; NCBI Protein GI: 23502758; NCBI Protein Accession: NP_698885.1 ZX, YH, AL Brucella rpoA ZX, YH, AL NCBI Gene GI: 1196492; NCBI Protein GI: 17987064; NCBI Protein Accession: NP_539698.1; NCBI Gene GI: 3788935; NCBI Protein GI: 82700043; NCBI Protein Accession: YP_414617.1; NCBI Gene GI: 1166885; NCBI Protein GI: 23502086; NCBI Protein Accession: NP_698213.1 Brucella rpsA NCBI Gene GI: 1197626; NCBI Protein GI: 17988198; NCBI Protein Accession: NP_540832.1; NCBI Gene GI: 3788939; NCBI Protein GI: 82698954; NCBI Protein Accession: YP_413528.1; NCBI Gene GI: 1165684; NCBI Protein GI: 23500942; NCBI Protein Accession: NP_697069.1 ZX, YH, AL Ribosomal protein S1 Brucella serB NCBI Gene GI: 1196326; NCBI Protein GI: 17986898; NCBI Protein Accession: NP_539532.1; NCBI Gene GI: 1167073; NCBI Protein GI: 23502262; NCBI Protein Accession: NP_698389.1 ZX, YH, AL Brucella SodC ZX, YH, AL NCBI Gene GI: 1198353; NCBI Protein GI: 17988926; NCBI Protein Accession: NP_541559.1; NCBI Gene GI: 3827840; NCBI Protein GI: 83269434; NCBI Protein Accession: YP_418725.1; NCBI Gene GI: 1165145; NCBI Protein GI: 23500443; NCBI Protein Accession: NP_699883.1 the assertion of "participates_in some 'smooth Brucella response to oxidative stress inside BCV'" is generated by GO annotation of sodC from Mycobacterium tuberculosis. Will also be good to check the EBI GOA files on : http://www.ebi.ac.uk/GOA/proteomes.html Brucella spotT NCBI Gene GI: 1197007; NCBI Protein GI: 17987579; NCBI Protein Accession: NP_540213.1; NCBI Gene GI: 1166315; NCBI Protein GI: 23501539; NCBI Protein Accession: NP_697666.1 ZX, YH, AL Brucella ssuB NCBI Gene GI: 1198571; NCBI Protein GI: 17989144; NCBI Protein Accession: NP_541777.1; NCBI Gene GI: 1164905; NCBI Protein GI: 23500215; NCBI Protein Accession: NP_699655.1 ZX, YH, AL Brucella thrA NCBI Gene GI: 1196436; NCBI Protein GI: 17987008; NCBI Protein Accession: NP_539642.1 ZX, YH, AL Brucella thrC ZX, YH, AL NCBI Gene GI: 1197161; NCBI Protein GI: 17987733; NCBI Protein Accession: NP_540367.1; NCBI Gene GI: 1166145; NCBI Protein GI: 23501385; NCBI Protein Accession: NP_697512.1 Brucella tig NCBI Gene GI: 1196780; NCBI Protein GI: 17987352; NCBI Protein Accession: NP_539986.1; NCBI Gene GI: 3787589; NCBI Protein GI: 82699768; NCBI Protein Accession: YP_414342.1; NCBI Gene GI: 1166567; NCBI Protein GI: 23501784; NCBI Protein Accession: NP_697911.1 ZX, YH, AL Brucella tldD ZX, YH, AL NCBI Gene GI: 1197179; NCBI Protein GI: 17987751; NCBI Protein Accession: NP_540385.1; NCBI Gene GI: 1166126; NCBI Protein GI: 23501366; NCBI Protein Accession: NP_697493.1 Brucella trkH NCBI Gene GI: 1196223; NCBI Protein GI: 17986795; NCBI Protein Accession: NP_539429.1 ZX, YH, AL Brucella ugpA ZX, YH, AL NCBI Gene GI: 1198363; NCBI Protein GI: 17988936; NCBI Protein Accession: NP_541569.1; NCBI Gene GI: 1198396; NCBI Protein GI: 17988969; NCBI Protein Accession: NP_541602.1; NCBI Gene GI: 3827693; NCBI Protein GI: 83269477; NCBI Protein Accession: YP_418768.1; NCBI Gene GI: 1165098; NCBI Protein GI: 23500400; NCBI Protein Accession: NP_699840.1; NCBI Gene GI: 1165134; NCBI Protein GI: 23500433; NCBI Protein Accession: NP_699873.1 Brucella ugpB ZX, YH, AL NCBI Gene GI: 3827694; NCBI Protein GI: 83269478; NCBI Protein Accession: YP_418769.1; NCBI Gene GI: 1165097; NCBI Protein GI: 23500399; NCBI Protein Accession: NP_699839.1 Brucella uppS NCBI Gene GI: 1196538; NCBI Protein GI: 17987110; NCBI Protein Accession: NP_539744.1; NCBI Gene GI: 1166834; NCBI Protein GI: 23502036; NCBI Protein Accession: NP_698163.1 ZX, YH, AL Brucella uvrA NCBI Gene GI: 1196589; NCBI Protein GI: 17987161; NCBI Protein Accession: NP_539795.1; NCBI Gene GI: 3787776; NCBI Protein GI: 82699947; NCBI Protein Accession: YP_414521.1; NCBI Gene GI: 1166780; NCBI Protein GI: 23501982; NCBI Protein Accession: NP_698109.1 ZX, YH, AL Brucella virb1 NCBI Gene GI: 1197796; NCBI Protein GI: 17988369; NCBI Protein Accession: NP_541002.1 ZX, YH, AL Brucella virB1 ZX, YH, AL NCBI Gene GI: 1164506; NCBI Protein GI: 23499836; NCBI Protein Accession: NP_699276.1 Brucella virb10 ZX, YH, AL NCBI Gene GI: 1197805; NCBI Protein GI: 17988378; NCBI Protein Accession: NP_541011.1 Brucella virB10 NCBI Gene GI: 1164497; NCBI Protein GI: 23499827; NCBI Protein Accession: NP_699267.1 ZX, YH, AL Brucella virb11 NCBI Gene GI: 1197806; NCBI Protein GI: 17988379; NCBI Protein Accession: NP_541012.1 ZX, YH, AL Brucella virB11 NCBI Gene GI: 1164496; NCBI Protein GI: 23499826; NCBI Protein Accession: NP_699266.1 ZX, YH, AL Brucella virB2 NCBI Gene GI: 1197797; NCBI Protein GI: 17988370; NCBI Protein Accession: NP_541003.1; NCBI Gene GI: 3827981; NCBI Protein GI: 83269021; NCBI Protein Accession: YP_418312.1; NCBI Gene GI: 1164505; NCBI Protein GI: 23499835; NCBI Protein Accession: NP_699275.1 ZX, YH, AL Brucella virB3 NCBI Gene GI: 1197798; NCBI Protein GI: 17988371; NCBI Protein Accession: NP_541004.1; NCBI Gene GI: 3827980; NCBI Protein GI: 83269020; NCBI Protein Accession: YP_418311.1; NCBI Gene GI: 1164504; NCBI Protein GI: 23499834; NCBI Protein Accession: NP_699274.1 ZX, YH, AL Brucella virb4 ZX, YH, AL NCBI Gene GI: 1197799; NCBI Protein GI: 17988372; NCBI Protein Accession: NP_541005.1 Brucella virB4 ZX, YH, AL NCBI Gene GI: 1164503; NCBI Protein GI: 23499833; NCBI Protein Accession: NP_699273.1 Brucella virB5 NCBI Gene GI: 1197800; NCBI Protein GI: 17988373; NCBI Protein Accession: NP_541006.1; NCBI Gene GI: 3827978; NCBI Protein GI: 83269018; NCBI Protein Accession: YP_418309.1; NCBI Gene GI: 1164502; NCBI Protein GI: 23499832; NCBI Protein Accession: NP_699272.1 Type IV secretion system protein virB5 ZX, YH, AL Brucella virb6 NCBI Gene GI: 1197801; NCBI Protein GI: 17988374; NCBI Protein Accession: NP_541007.1 ZX, YH, AL Brucella virB6 ZX, YH, AL NCBI Gene GI: 1164501; NCBI Protein GI: 23499831; NCBI Protein Accession: NP_699271.1 Brucella virB8 Type IV secretion system protein virB8 ZX, YH, AL NCBI Gene GI: 1197803; NCBI Protein GI: 17988376; NCBI Protein Accession: NP_541009.1; NCBI Gene GI: 3827898; NCBI Protein GI: 83269015; NCBI Protein Accession: YP_418306.1; NCBI Gene GI: 1164499; NCBI Protein GI: 23499829; NCBI Protein Accession: NP_699269.1 Brucella virb9 NCBI Gene GI: 1197804; NCBI Protein GI: 17988377; NCBI Protein Accession: NP_541010.1 ZX, YH, AL Brucella virB9 NCBI Gene GI: 1164498; NCBI Protein GI: 23499828; NCBI Protein Accession: NP_699268.1 ZX, YH, AL Brucella vjbR ZX, YH, AL NCBI Gene GI: 1198888; NCBI Protein GI: 17989461; NCBI Protein Accession: NP_542094.1; NCBI Gene GI: 1164556; NCBI Protein GI: 23499883; NCBI Protein Accession: NP_699323.1 Brucella vsrB ZX, YH, AL NCBI Gene GI: 1197317; NCBI Protein GI: 17987889; NCBI Protein Accession: NP_540523.1; NCBI Gene GI: 1165977; NCBI Protein GI: 23501223; NCBI Protein Accession: NP_697350.1 Brucella wbdA ZX, YH, AL NCBI Gene GI: 1196708; NCBI Protein GI: 17987280; NCBI Protein Accession: NP_539914.1; NCBI Gene GI: 1166655; NCBI Protein GI: 23501863; NCBI Protein Accession: NP_697990.1 Brucella wbkA NCBI Gene GI: 1197115; NCBI Protein GI: 17987687; NCBI Protein Accession: NP_540321.1; NCBI Gene GI: 1166191; NCBI Protein GI: 23501421; NCBI Protein Accession: NP_697548.1 ZX, YH, AL Brucella wbkB ZX, YH, AL NCBI Gene GI: 1166180; NCBI Protein GI: 23501413; NCBI Protein Accession: NP_697540.1 Brucella wbpL ZX, YH, AL NCBI Gene GI: 1197137; NCBI Protein GI: 17987709; NCBI Protein Accession: NP_540343.1; NCBI Gene GI: 1166172; NCBI Protein GI: 23501411; NCBI Protein Accession: NP_697538.1 Brucella wbpW NCBI Gene GI: 1198672; NCBI Protein GI: 17989245; NCBI Protein Accession: NP_541878.1; NCBI Gene GI: 1164785; NCBI Protein GI: 23500100; NCBI Protein Accession: NP_699540.1 ZX, YH, AL Brucella wbpZ ZX, YH, AL NCBI Gene GI: 1197104; NCBI Protein GI: 17987676; NCBI Protein Accession: NP_540310.1; NCBI Gene GI: 1166202; NCBI Protein GI: 23501429; NCBI Protein Accession: NP_697556.1 Brucella xfp NCBI Gene GI: 1198653; NCBI Protein GI: 17989226; NCBI Protein Accession: NP_541859.1; NCBI Gene GI: 1164823; NCBI Protein GI: 23500138; NCBI Protein Accession: NP_699578.1 ZX, YH, AL Brucella xseA ZX, YH, AL NCBI Gene GI: 1198299; NCBI Protein GI: 17988872; NCBI Protein Accession: NP_541505.1; NCBI Gene GI: 3827916; NCBI Protein GI: 83269378; NCBI Protein Accession: YP_418669.1; NCBI Gene GI: 1165206; NCBI Protein GI: 23500501; NCBI Protein Accession: NP_699941.1 Brucella znuA ZX, YH, AL NCBI Gene GI: 1197949; NCBI Protein GI: 17988522; NCBI Protein Accession: NP_541155.1; NCBI Gene GI: 3827700; NCBI Protein GI: 83269918; NCBI Protein Accession: YP_419209.1; NCBI Gene GI: 1165575; NCBI Protein GI: 23500837; NCBI Protein Accession: NP_700277.1 Brucella znuC ZX, YH, AL NCBI Gene GI: 1197948; NCBI Protein GI: 17988521; NCBI Protein Accession: NP_541154.1; NCBI Gene GI: 3827702; NCBI Protein GI: 83269919; NCBI Protein Accession: YP_419210.1; NCBI Gene GI: 1165576; NCBI Protein GI: 23500838; NCBI Protein Accession: NP_700278.1 Brucella zwf Glucose-6-phosphate 1-dehydrogenase NCBI Gene GI: 1198285; NCBI Protein GI: 17988858; NCBI Protein Accession: NP_541491.1; NCBI Gene GI: 1165220; NCBI Protein GI: 23500514; NCBI Protein Accession: NP_699954.1 ZX, YH, AL genetic material DNA sequence the physical DNA sequence that is part of a chromosome Y.L. cattle brucellosis disease course bovine brucellosis disease course the brucellosis disease course happened in a cattle sheep brucellosis disease course YL the brucellosis disease course happened in a sheep swine brucellosis disease course YL the brucellosis disease course happened in a swine cattle brucellosis pathogen role a brucellosis pathogen role that is beared in cattle. YL, YH human brucellosis pathogen role YL, YH a brucellosis pathogen role that is beared in human. brucellosis human patient Brucella infected dog Brucella protein virulence factor Brucella protein that bears Brucella virulence factor disposition YL YL,YH process of establishing Brucella infection in host patient role YL, YH a role of being a patient. should be replaced by OBI term brucellosis patient role YL, YH a patient role that is for brucellosis patient. drinking function a function of drinking that is realized by a drinking process. YL, YH milk drinking function YL, YH a drinking function that is for drinking milk. milk producing disposition a disposition that produces milk. YL, YH Brucella-contaminated milk YL extended milk that has brucella as its part YL milk producing process B. abortus 16S rRNA PCR primer bacterial O-polysaccharide 'temporal distribution of Brucellosis' S. Ali The description of the occurence of Brucellosis over time. Brucella lipopolysaccharide YH, YL Brucella LPS a bacterial lipopolsaccharide that is from Brucella. Brucella abortus lipopolysaccharide YL,YH YL brucella lipopolysaccharide that is part of Brucella abortus Brucella melitensis lipopolysaccharide Brucella lipopolysaccharide that is part of Brucella melitensis YL YL,YH Brucella suis lipopolysaccharide Brucella lipopolysaccharide that is part of Brucella suis Brucella O-polysaccharide Brucella abortus O-polysaccharide Brucella melitensis O-polysaccharide Brucella suis O-polysaccharide brucellosis pathogen role YL, YH a pathogen role of being a brucellosis pathogen. Brucella host role YL, YH An infectious angent host role borne by an organism in virtue of the fact that its extended organism contains Brucella. goat brucellosis pathogen role a brucellosis pathogen role that is beared in goat. YL, YH sheep brucellosis pathogen role YL, YH a brucellosis pathogen role that is beared in sheep. camel brucellosis pathogen role YL, YH a brucellosis pathogen role that is beared in camel. pig brucellosis pathogen role a brucellosis pathogen role that is beared in pig. YL, YH dog brucellosis pathogen role YL, YH a brucellosis pathogen role that is beared in dog. dog brucellosis YL, YH brucellosis that is beared by a dog. camel brucellosis brucellosis that is beared by a camel. YL, YH goat brucellosis YL, YH brucellosis that is beared by a goat. geographic region goat brucellosis disease course YL the brucellosis disease course happened in a goat sheep brucellosis symptom a brucellosis symptom shown in a sheep. YL, YH camel brucellosis symptom a brucellosis system shown in camel. YL, YH camel brucellosis disease course YL the brucellosis disease course happened in a camel dog brucellosis disease course YL the brucellosis disease course happened in a dog dog brucellosis symptom a brucellosis symptom shown in a dog. YL, YH infectious disease endemic geographical region infectious disease free geographical region infectious disease non-endemic geographical region brucellosis endemic geographical region Salwa Ali brucellosis free geographical region Salwa Ali brucellosis non-endemic geographical region Salwa Ali brucellosis pathological bodily process Y.L. YL a pathological bodily process that happens in brucellosis aerosolized Brucella YL aerosolized Brucella is a subclass of Brucella? it is Brucella in another form. How shall we represent this? Brucella aerosolization YL the planned process that has out put of an aerosol -- a fine mist or spray containing minute particles of brucella eradication of human brucellosis S.A., Y.L. YL brucellosis eradication that has objective of reducing human brucellosis brucellosis epidemic YL realization of brucellosis that become epidemic disinfection of aerosolized Brucella the process of controling aerosolized Brucella that has a output of reduced or eliminated aerosolized Brucella in the air. YL bleach disinfection of aerosolized Brucella YL disinfection process of aerosolized Brucella that has a input of bleach bleach YL bleach that is a disinfectant and bears disinfectant role YL,YH Bleach refers to a number of chemicals that remove color, whiten, or disinfect, often via oxidation.Many bleaches have strong bactericidal properties, and are used for disinfecting and sterilizing. (http://en.wikipedia.org/wiki/Bleach) human brucellosis epidemic YL brucellosis epdiemic that happened in human non-human brucellosis epidemic YL brucellosis epdiemic that happened in non-human organism Brucella contaminated milk producing process Brucella vaccine preparation vaccine preparation that has a objective of preventing brucella infection Brucella infection incidence YL , YH an infection incidence that occurs in brucellosis patients. Brucella infection incidence proportion an infection incidence proportion that happens in Brucella infection. YL, YH Brucella infection incidence rate YL, YH an infection incidence rate that occurs for Brucella infection. Brucella infection prevalence an infection prevalence that is for Brucella infection. YL, YH brucellosis endemicity an infectious disease endemicity that is specifically for brucellosis. YL, YH human brucellosis endemicity YL, YH a brucellosis endemicity that is specifically for human brucellosis. non-human brucellosis endemicity a brucellosis endemicity that is specifically for non-human brucellosis. YL, YH brucellosis hyper-endemicity YL, YH an infectious disease hyper-endemicity that is specifically for brucellosis. human brcuellosis hyper-endemicity YL, YH a brucellosis hyper-endomicity is that specifically for human brucellosis. non-human brucellosis hyper-endemicity a brucellosis hyper-endomicity is that specifically for non-human brucellosis. YL, YH brucellosis incidence an infectious disease incidencea that is specifically for brucellosis. YL, YH human brucellosis incidence YL, YH a brucellosis incidencea that is specifically for human brucellosis. non-human brucellosis incidence a brucellosis incidencea that is specifically for non-human brucellosis. YL, YH brucellosis incidence proportion an infectious disease incidence proportion that is specifically for brucellosis. YL, YH human brucellosis incidence proportion YL, YH a brucellosis incidence proportion that is specifically for human brucellosis. non-human brucellosis incidence proportion YL, YH a brucellosis incidence proportion that is specifically for non-human brucellosis. brucellosis endemic rate an infectious disease endemic rate that is specifically for brucellosis. YL, YH human brucellosis endemic rate YL, YH a brucellosis endemic rate that is specifically for human brucellosis. non-human brucellosis endemic rate YL, YH a brucellosis endemic rate that is specifically for non-human brucellosis. brucellosis mortality rate an infectiuos disease mortality rate that is specfically for brucellosis. YL, YH SodC from B. abortus strain 2308 ZX, YH, AL NCBI Gene GI: 3827840; NCBI Protein GI: 83269434; NCBI Protein Accession: YP_418725.1; PDB Accession: 2AQM Bfr from B. abortus S19 NCBI Gene GI: 6326162; NCBI Protein GI: 189022832; NCBI Protein Accession: YP_001932573 ZX, YH, AL RplL from Brucella melitensis biovar Abortus 2308 NCBI Gene GI: 3788918; NCBI Protein GI: 82700077; NCBI Protein Accession: YP_414651 ZX, YH, AL ORF NCBI Protein GI: 599654; NCBI Protein Accession: CAA86936.1; PDB Accession: 1DI0; NCBI Nucleotide GI: 599653 ZX, YH, AL ribosomal protein 19 L7/L12 ZX, YH, AL NCBI Protein GI: 304271 Omp31 from Brucella melitensis biovar Abortus 2308 NCBI Gene GI: 3788834; NCBI Protein GI: 82700421; NCBI Protein Accession: YP_414995 ZX, YH, AL immunogenic 39-kDa protein [Brucella melitensis] no COG annotation yet ZX, YH, AL NCBI Protein GI: 122892474; NCBI Protein Accession: ABM67295 znuA from Brucella abortus bv. 1 str. 9-941 NCBI Gene GI: 3341411; NCBI Protein GI: 62317941; NCBI Protein Accession: YP_223794 ZX, YH, AL Bp26 from Brucella melitensis 16M ZX, YH, AL NCBI Gene GI: 1196247; NCBI Protein GI: 17986819; NCBI Protein Accession: NP_539453 RpsL from Brucella melitensis bv. 1 str. 16M ZX, YH, AL NCBI Gene GI: 1196463; NCBI Protein GI: 161511151; NCBI Protein Accession: NP_539669 Gap from Brucella abortus bv. 1 str. 9-941 ZX, YH, AL NCBI Gene GI: 3340207; NCBI Protein GI: 62290600; NCBI Protein Accession: YP_222393 Omp25 from Brucella melitensis bv. 1 str. 16M NCBI Gene GI: 1196960; NCBI Protein GI: 17987532; NCBI Protein Accession: NP_540166 ZX, YH, AL IalB from Brucella melitensis bv. 1 str. 16M NCBI Gene GI: 1197295; NCBI Protein GI: 17987867; NCBI Protein Accession: NP_540501 ZX, YH, AL Bfr from B. melitensis biovar Abortus 2308 ZX, YH, AL NCBI Gene GI: 3828133; NCBI Protein GI: 83269559; NCBI Protein Accession: YP_418850; PDB Accession: 3FVB Tig from Brucella melitensis bv. 1 str. 16M ZX, YH, AL NCBI Gene GI: 1196780; NCBI Protein GI: 17987352; NCBI Protein Accession: NP_539986 DnaK from Brucella abortus bv. 1 str. 9-941 ZX, YH, AL NCBI Gene GI: 3341115; NCBI Protein GI: 62290965; NCBI Protein Accession: YP_222758 SurA from Brucella melitensis biovar Abortus 2308 NCBI Gene GI: 3787419; NCBI Protein GI: 82699574; NCBI Protein Accession: YP_414148 ZX, YH, AL Omp19 from Brucella melitensis biovar Abortus 2308 ZX, YH, AL NCBI Gene GI: 3788831; NCBI Protein GI: 82700695; NCBI Protein Accession: YP_415269 Omp16 from Brucella melitensis biovar Abortus 2308 ZX, YH, AL NCBI Gene GI: 3788229; NCBI Protein GI: 82700483; NCBI Protein Accession: YP_415057 brucellosis lifetime prevalence an infectious disease lifetime prevalence that is specifically for brucellosis. YL, YH brucellosis endemic level YL, YH an infectious disease endemic level that is specfically for brucellosis. brucellosis sporadicity YL, YH an infectious disease sporadicity that is specfically for brucellosis. brucellosis control program the process of controlling brucellosis that inteded to prevent the occurence of brucellosis Y.L. WHO standard doxycycline treatement for human brucellosis YL human brucellosis treatment that is a standard in WHO, and uses docycycline as input,and is a part of WHO standard treatment for human brucellosis in adults and children eight years of age and older WHO standard streptomycin treatment for human brucellosis YL human brucellosis treatment that is a standard in WHO, and uses streptomycin as input, and it is a part of WHO standard treatment for human brucellosis in adults and children eight years of age and older objective of amplyfing a 193 region located in gene omp-2 PCR product of PCR assay for detecting Brucella omp-2 laboratory finding of Brucella omp-2 detection infectious disease endemic site YL a site that is infectious disease endemic submit to IDO-core brucellosis endemic site SA YL an infectious disease endemic site that is specific for brucellosis infectious disease free site SA YL a site that is considered as infectious disease free submit to IDO brucellosis free site SA YL an infectious disease free site that is specific for brucellosis infectious disease non-endemic site SA YL a site that is considered infectious disease non-endemic brucellosis non-endemic site SA YL an infectious disease non-endemic site that is specific for brucellosis. In these countries, the disease in humans has been controlled through the implementation of eradication programs, however cases do still occur and thus they cannot be considered completely free of the disease. protein coding gene YL YL a DNA sequence that codes for protein Brucella protein coding gene protein coding gene that is part of Brucella YL Y.L. chromosome of Brucella spp. YL A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions. (http://en.wikipedia.org/wiki/Chromosome) a genetic material that is an organized structure of DNA and protein found in Brucella cells. BMEI1258 gene Brucella protein coding gene that codes for iABC transporter ATP-binding protein of Brucella melitensis bv.1. str. 16M YL YL protein coding gene sequence data Y.L.,YH,ZX DNA sequence data that is about a gene that codes for a protein Brucella protein coding gene sequence data Y.L.,YH,ZX protein coding gene sequence data that is for Brucella protein COG0488 R BMEI1258 Phigen 1307092 1305152 + NCBI:Gene YL NCBI's locus tag BMEI1258 that is about BMEI1258 ABC transporter ATP-binding protein symbol of gene Y.L.,YH,ZX a symbol that represents a gene symbol of protein Y.L.,YH,ZX a symbol that represent protein COG annotation of Brucella protein NCBI:COG COG ID assigned for Brucella protein. YL Y.L.,YH,ZX amino acid sequence data will replaced by a OBI term Brucella protein amino acid sequence data YL amino acid sequence data that is about Brucella protein's primary structure. Brucella abortus ribosomal protein L7/L12 gene seuqence data Brucella protein coding gene sequence data that is about ribosomal protein L7/L12 Y.L. Brucella rplL gene Gene ID 6328728 Brucella protein coding gene that codes for rpIL 50S ribosomal protein L7/L12 of Brucella abortus S12 Y.L. YL http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&list_uids=6328728 BMEI1339 gene Brucella protein coding gene that codes for hypothetical protein BMEI1339 of Brucella melitensis bv.1. str. 16M YL YL genomic annotation the annotation made based on the genomic region of a genome. Different database (i.e.,NCBI, Ensembl) has different annotation of a certain region or gene. Such as the start position and end position of a gene, cds, ect. Y.L. BMEI1339 1394072 Phigen - NCBI:Gene 1394383 YL NCBI's locus tag BMEI1339 that is about BMEI hypothetical protien locus tag in NCBI YL NCBI's gene location annotation using locus tag. BAbS19_I11800 NCBI:Gene - Phigen 1231097 1231471 YL NCBI's locus tag BAbS19_I11800 that is about rpIL 50s ribosomal protein L7/L12 COG0222 J Y.L. functional categories:J Brucella melitensis strain M5 probably equal to 16M PCR assay for detecting Brucella omp-2 a PCR test for brucellosis that is designed to detect Brucella omp2 gene. YH, YL, ZX PubMed: 8586678 This is a versatile method for the extraction of Brucella DNA and PCR are presented as reliable tools for the detection of Brucella spp. from body fluids of infected animals. Two oligonucleotides homologous to regions of the gene encoding for an outer membrane protein (OMP-2) were designed to detect the pathogen from milk and/or blood of infected goats, bovine, and human patients. The sensitivity of our test and its ability to detect the pathogen in samples from the field reveal a promising advance in the diagnosis of brucellosis in animals and humans. geographic distribution "Geography of Disease." Encyclopedia of Public Health. Ed. Lester Breslow. Gale Cengage, 2002. eNotes.com. 2006. 12 Sep, 2011 <http://www.enotes.com/public-health-encyclopedia/ geography-disease> The study of disease distribution, or the geography of disease, reveals real differences in disease distribution among nations and in regions within nations. It is a simple way to draw attention to the disease risks associated with particular environments. Brucella melitensis strain M5 immunogenic 39-kDa protein gene, complete cds Genebank Brucella protein codling gene sequence data that is about an immunogenic 39-kDa protein gene, which is a part of Brucella melitensis strain M5 Y.L. complete cd Genebank Accsssion: EF189139 BMEI0085 gene BMEI0085 Y.L. YL Beucella protein coding gene that codes BMEI0085 hypothetical protein BMEI0085 84529 NCBI:Gene Phigen 84257 YL NCBI's locus tag BMEI0085 that is about hypothetical protein of Brucella melitensis 16M reemerging disease Salwa Ali Re-emerging infectious diseases are diseases that once were major health problems globally or in a particular country, and then declined dramatically, but are again becoming health problems for a significant proportion of the population. chromosome 1 of Brucella melitensis 16M the chromosome 1 that found in Brucella melitensis 16M's cell COG5567 N Y.L. function categories:N BMEI0455 gene BMEI0455 YL Beucella protein coding gene that codes glutathione S-transferase BMEI0455 - NCBI:Gene Phigen 475757 474774 NCBI's locus tag BMEI0455 that is BMEI0455 gkutathione S-transferase COG0435 O functional categories: O BMEI0671 gene BMEI0671 Brucella protein coding gene that codes for integral membrane protein / hemolysin of Brucella melitensis bv.1. str. 16M YL YL BMEI0671 Phigen NCBI:Gene 694042 692474 + YL NCBI's locus tag BMEI0671 that is about BMEI0671 integral membrane protein COG0861 P functional categories: P Brucella infected skin BMEI1229 gene BMEI1229 Brucella protein coding gene that codes for exonuclease of Brucella melitensis bv.1. str. 16M YL YL BMEI1229 1278803 1279414 NCBI:Gene + Phigen NCBI's locus tag BMEI1229 that is about BMEI1399 exnuclease YL COG2176 L functional categories: L animal dealer role YL, YH a role of being an animal dealer laboratory worker role a role of being a lab worker YL, YH research worker role YL, YH a role of being a research worker. veterinarian role YL, YH a role of being a veterinarian. abattoir worker role a role of being an abattoir worker. YL, YH butcher role a role of being a butcher YL, YH dog owner role a role of being a dog owner YL, YH dog handler role YL, YH a role of being a dog handler occupational disease An occupational disease is any chronic ailment that occurs as a result of work or occupational activity. YL, YH reemerging infectious disease Re-emerging infectious diseases are diseases that once were major health problems globally or in a particular country, and then declined dramatically, but are again becoming health problems for a significant proportion of the population either due to upward trends in incidence or prevalence or because they show novel outbreak ranges (geographical or host). Salwa Ali endemic disease YL, YH a disease that is endemic. non-endemic disease YL, YH a disease that is not endemic. brcucellosis outbreak in epidemiology, the occurrence of infection with a particular disease in a small, localized group, such as the population of a village. The term is sometimes used more broadly to refer to an epidemic or a pandemic. (http://medical-dictionary.thefreedictionary.com/outbreak) the occurence of brucellosis SA, YL disease cluster A disease cluster refers to a grouping of diseases that are related temporally and in proximity. YL, YH Brucells infected aerosol PCR product sequence data The DNA sequence data of a PCR product YL disease cluster SA (1) Two or more cases of a relatively uncommon event or disease related in time and/or place perceived to be greater than expected by chance (2) An unusual aggregation, real or perceived, of health events that are grouped together in time and space, which is reported to a public health department (http://medical-dictionary.thefreedictionary.com/Disease+Cluster) regional variation of brucellosis The differences in distribution of Brucellosis among nations and in regions within nations. SA,YL The regional difference of the epidemic of brucellosis. It is often due to the geographical, social, and medical differences. seasonal variation of brucellosis Brucellosis in humans and animals By Michael J. Corbel, World Health Organization, Food and Agriculture Organization of the United Nations, International Office of Epizootics The epidemic variataion of brucellosis due to the seasonal changes. Although Brucellosis can be contracted at any time of the year, it has been reported to show a seasonal trend or pattern of change meaning that there are periodic regular fluctuatiions in disease incidence that are related to particular seasons. Fluctuations may be caused by changes in host density, managemnet practices, survival of infectious agents, vector dynamics, and other ecological factors. For example: In countries with temperate or cold climates there is a marked seasonal variation in the incidence of acute brucellosis, with most cases occuring in the spring or summer, coinciding with the peak period for abortions or parturitions among farm animals and hence for the highest level of exposure of those attending the animals and consuming thier milk. There are also other reasons for this seasonal trend in other countries, such as the tropical and subtropical areas i.e. Saudi Arabia, where cases occur more in the spring and fall when it is a local tradition to go for desert expeditions. SA,YL animal husbandary SA YL a process of breeding and raising livestock. contact transmission process SA YL a transmission process of which the disease agent is transferred directly by biting, sucking, chewing or indirectly by inhalation of droplets, drinking of contaminated water, traveling in contaminated vehicles. food-borne transmission process the disease transmission process of which the disease agent is spread by consuming contaminated food or drink. SA YL Brucella entry into macrophages YL YL entry of Brucella into macrophages that bears a Brucella host role air-borne transmission process SA YL spread of infection by droplet nuclei or dust through the air. Brucella's intracellular replication in macrophage YL YL the biological process happened while Brucella replicated itself inside the marcrophage cells. process of Brucella intracellular survival in macrophage YL YL the biological processof brcuella's survival inside the macrophage cell that is part of the process of establishing Brucella infection establishment of Brucella intracellular localization YL YL the establishment of localization in cell that has Brucella as a participant, and make Brucella establish a intracellular location establishment of Brucella macrophage localization YL YL the process of Brucella to establish its localization into macrophage cell B.abortus genome sequence data YL the DNA sequence data that is about the primary structure of B.abortus genome. sequence data of 139bp's region located in Brucella omp-2 gene a DNA sequence data that is about a 139bp's region located in Brucella omp-2 gene YL Burcella omp-2 gene sequence data YL DNA sequence data that is about Brucella omp-2 gene. continuous treatment duration YH, YL a temporal interval for a continuous treatment normal temperature a human body temperature that is considered normal. YL Most people think of a "normal" body temperature as an oral temperature of 98.6°F (37°C). This is an average of normal body temperatures. Your temperature may actually be 1°F (0.6°C) or more above or below 98.6°F (37°C). Also, your normal body temperature changes by as much as 1°F (0.6°C) throughout the day, depending on how active you are and the time of day. Body temperature is very sensitive to hormone levels and may be higher or lower when a woman is ovulating or having her menstrual period. (http://firstaid.webmd.com/body-temperature) elevated temperature a sign that shows elevated temperature. YL, YH body temperature staying normal YL the bodily process when body temperature measures as a normal temperature. body temperature elevation YL YL,YH the process of body temperature's going up. mornings during the course of disease YL mornings (from sun rise to 12pm) within the time span of diseae course afternoons during the course of disease YL all the afternoons (from 12pm to sunset time) within the time span of disease course livestock Livestock refers to one or more domesticated animals raised in an agricultural setting to produce commodities such as food, fiber and labor. The term "livestock" as used in this article does not include poultry or farmed fish; however the inclusion of these, especially poultry, within the meaning of "livestock" is common. (http://en.wikipedia.org/wiki/Livestock) domestic animal that bears a food production role. YL S.A. dairy products YL S.A. a material entity that is made from milk, and it is an output of a dariy factory's dairy production facility. delivery of Brucella infected livestock S.A. YL the process of moving Brucella infected livestock from one site to another site. abortion of Brucella infected livestock S.A. YL abortion process happens in a Brucella infectied livestock traditional eating habits the habit and customs of eating in a certion country or region that has been a tradition YL S.A. international travel S.A. a process of travel from one country to another country importation of dairy products S.A. YL the process of importing dariy products from abroad country Brucella infected meat extended meat that has brucella as its part S.A. Brucella infected liver extended liver that has brucella as its part. S.A. Brucella infected bone marrow S.A. extended bone marrow that has brucella as part. farmer role a role of being a farmer S.A. dairy worker role S.A. a role of being a dairy worker herdsman role a role of being a herdsman S.A. cattle rancher role a role of being a cattle rancher S.A. shepherd role S.A., YH a role of being a shepherd. Brucella infected products of conception country YL, SA. Since the political border is changing historically. A country specified the year is its instance. For example, People's Republic of China in 1950. a site that has a political border desrcibed by a geographical boundary, including all the entities ocuppies within this geographical boundary, such as people, building, river, mines, and so on. quarantine restriction of movement of individuals who have been exposed to infectious or communicable disease in order to prevent its spread (From Dorland, 28th ed & Black's Veterinary Dictionary, 17th ed). S.A. Salwa Ali Brucella omp-2 gene Brucella protein coding gene that codes for omp2 protein of Brucella YL YL Channel Islands Declared Brucellosis free in 1935. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. Norway S.A. Declared Brucellosis free in 1952. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Sweden Declared Brucellosis free in 1957. S.A. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour screening Salwa Ali The evaluation of an asymptomatic person in a population, or examination of a large sample of animals in a population, to detect an unsuspected disease process not known to exist at the time of evaluation. Finland Declared Brucellosis free in 1960. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. Denmark Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. Declared Brucellosis free in 1962. Switzerland Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. Declared Brucellosis free in 1963. biosurveillance Monitoring of information sources of potential value in detecting an emerging epidemic, whether naturally occurring or the result of bioterrorism. Salwa Ali Rumania Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Declared Brucellosis free in 1969. S.A. United Kingdom S.A. Scotland was declared Brucellosis free in 1980, while England and Wales were declared free in 1981. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Netherlands Declared Brucelllosis free in 1985. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. brucellosis surveillance Austria Greece Austria was declared Brucellosis free in 1985. Salwa Ali Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Luxembourg S.A. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Declared Brucellosis free in 1985. Cyprus Declared Brucellosis free in 1985. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. disease surveillance system Salwa Ali A surveillance system is an information loop or cycle that involves health care proviers, public health agencies, and the public. A well functioning disease surveillance system includes case detection and registration, case confirmation, data reporting, data analysis, outbreak investigation, response and preparedness activities, feedback, and communication. Reference: Strengthening National Public Health Preparedness and Response to Chemical, Biological, and Radiological Agent Threats. Edited by C.E. Cummings and E. Stikova. IOS Press, 2007. P.25. Falkland Islands Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Declred Brucellosis free in 1994. S.A. Iceland Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour S.A. Iceland has always been Brucellosis free. US Virgin Islands US Virgin Islands have always been Brucellosis free. S.A. Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour USA S.A. Australia S.A. Canada S.A. France S.A. Mexico S.A. brucellosis health education Education that increases the awareness and favorably influences the attitudes and knowledge relating to the improvement of health on a personal or community basis. Salwa Ali Peru S.A. Argentina S.A. Spain S.A. Italy S.A. Portugal S.A. DNA extracted from brucellosis patient derived specimen Albania S.A. Republic of Macedonia S.A. Algeria S.A. Syria S.A. Turkey S.A. Iran S.A. Iraq S.A. Saudi Arabia S.A. Oman S.A. Kuwait S.A. Lebanon S.A. Kyrgyzstan S.A. Tajikistan S.A. Kazakhstan S.A. Armenia S.A. Turkmenistan S.A. Georgia S.A. Uzbekistan China S.A. India S.A. Mongolia S.A. Tibet S.A. smooth Brucella the smooth Brucella strain is Brucella that has a smooth lipopolysaccharide as its part. (smooth lipopolysaccharide has surface expression of the O polysaccharide ) Y.L. Brucella infection test by blood culturing S.A. YL brucella infection test by culturing the blood dervied from patient. Brucella infection test by milk culturing S.A. YL brucella infection test culturing milk derived from infected non-human organism B.abortus genome YL YL. a genome that is part of Brucella abortus biohazard containment S.A. Provision of physical and biological barriers to the dissemination of potentially hazardous biologically active agents (bacteria, viruses, recombinant DNA, etc.). Physical containment involves the use of special equipment, facilities, and procedures to prevent the escape of the agent. Biological containment includes use of immune personnel and the selection of agents and hosts that will minimize the risk should the agent escape the containment facility. Salwa Ali rough Brucella the rough Brucella strain is Brucella that has a rough lipopolysaccharide as its part. (rough lipopolysaccharide is lack of surface expression or reduced surface expression of the O polysaccharide ) Y.L. brucellosis diagnostic process YL the diagnostic process of making diagnosis of brucellosis Health Surveillance Salwa Ali TeutschSM & Churchill RE (eds). Principles and Practice of Public Health Surveillance, 2nded.Oxford University Press, 2000. Ongoing, systematic collection, analysis, interpretation and dissemination of health-related data essential for public health practice (i.e. prevention and control of disease). Surveillance applies to both human and vetiranary diseases, may be general or sentinal, and may be active or passive. Surveillance may be for health events (such as deaths or disease), health services (vaccinations, hospital admissions), health behaviors (smoking, alcohol), or even risk factors (water supply, travel). disease surveillance Salwa Ali Czechoslavakia salwa Ali Madkour's Brucellosis (Second Edition) 2000 by M. Monir Madkour Declared Brucellosis free in 1964. health services surveillance Salwa Ali infectious disease reemergence site Re-emerging infectious diseases are diseases that once were major health problems globally or in a particular country, and then declined dramatically, but are again becoming health problems for a significant proportion of the population. SA Salwa Ali brucellosis reemergence site These are countries or parts of countries where Brucellosis has reappeared after a significant decline in incidence SA SA Japan Since 1999, 11 cases in Japan have been reported. PMID: 20587207 Germany PMID: 18258041 Trends in the epidemiology of human brucellosis in Germany show that after a steady decrease in brucellosis incidence from 1962 to the 1980s, a persistent number of cases has been reported in recent years, with the highest incidence in Turkish immigrants. Bulgaria PMID: 19193282 Bulgaria had been free from brucellosis since 1958, but during 2005–2007, a reemergence of human and animal disease was recorded. Federation of Bosnia and Herzegovina Salwa Ali PMC2931440 Bosnia and Herzegovina was free of brucellosis from 1980 until 2000. Since then, the number of infected people in the country has rapidly increased, and infections have been recorded at almost the entire territory. In the recent years, brucellosis has been present continuously, with a changing morbidity rate and an overall tendency to increase. Thus, it has become an important public health problem in the country. B. abortus host role a role of being a B. abortus host. YL, YH vaccination surveillance Salwa Ali health behavior surveillance Surveillance of certain health related behaviors i.e. smoking, alcohol or drug use. The Behavioral Risk Factor Surveillance System (BRFSS) is the world’s largest, on-going telephone health survey system, established by the CDC for tracking health conditions and risk behaviors in the United States yearly since 1984. Salwa Ali http://www.cdc.gov/BRFSS/ environmental surveillance Surveillance of environmental factors (ie. water, air, and food quaility) that may influence health, but independently of any health events associated with them. Salwa Ali human disease surveillance animal disease surveillance infectious disease surveillance noninfectious disease surveillance Brucella containment SA YL biohazard containment that is for brucella syndromic surveillance According to a CDC definition, "the term 'syndromic surveillance' applies to surveillance using health-related data that precede diagnosis and signal a sufficient probability of a case or an outbreak to warrant further public health response. Though historically syndromic surveillance has been utilized to target investigation of potential cases, its utility for detecting outbreaks associated with bioterrorism is increasingly being explored by public health officials." Syndromic surveillance systems monitor data from school absenteeism logs, emergency call systems, hospitals' over-the-counter drug sale records, Internet searches, and other data sources to detect unusual patterns, alerting health professionals and pssibly anticipating a disease outbreak. http://www.webcitation.org/5LKEYsrRT Brucella canis host role a role of being a B. canis host. YL, YH Brucella melitensis host role a role of being a B. melitensis host. YL, YH Brucella cetaceae host role YL, YH a role of being a B. cetaceae host. Brucella neotomae host role YL, YH a role of being a B. neotomae host. Brucella ovis host role YL, YH a role of being a B. ovis host. Brucella pinnipediae host role YL, YH a role of being a B. pinnipediae host. process of establishing Brucella infection in macrophage bioterrorism agent role a role of beign a bioterrorism agent YL, YH administrating doxycycline 100mg twice a day YL a antibiotic brucellosis treatment that uses doxycycline 100mg twice a day. administrating streptomycin 1g a day YL a antibiotic brucellosis treatment that uses sterptomycin 1g once a day. smooth Brucella lipopolysaccharide a Brucella lipopolysaccharide that has Brucella O polysaccharide as its intergal part rough Brucella lipopolysaccharide Y.L. a Brucella lipopolysaccharide that has no 'O polysaccharide' as its part host-Brucella interaction Y.L. ‘host-Brucella interaction’ is ‘a process that Brucella and its host have effects upon each other during the course of Brucella’s establishing the infection and the host’s responses in order to fight the infection’. All those processes fall into two categories: Brucella infect host process or host anit-Brucella process. Brucella virulence Brucella T4SS substrate role Y.L. Y.L. a role inheres in a Brucella protein or a DNA-complex upon which the Brucella T4SS acts, and it is realized in the processes where Brucella T4SS acts as an agent. Brucella T4SS effector Y.L. Y.L. a material entity that bears the Brucella T4SS substrate role Brucella RicA RicA(Rab2 interacting conserved protein A) encoded by gene BMEI0736 from B. abortus interacts with human protein Rab2{de Barsy, 2011:21501366}. Y.L. D-erythrulose-1-phosphate dehydrogenase [Brucella abortus] encoded by eryC gene in Brucella abortus Brucella eryC gene Brucella erythritol catabolic process negative regulation of intracellular replication in macrophage macrophage-smooth Brucella interaction macrophage-rough Brucella interaction dendritic cell-rough Brucella interaction dendritic cell- smooth Brucella interaction epithelial cell - smooth Brucella interaction epithelial cell - rough Brucella interaction artificially mutated Brucella Y.L. a proessed material that is generated by mutate one or more genes inside Brucella's genome, which results in the lack of experssion of those genes, and Brucella lacks the proteins encoded by mutated genes as its part. B. abortus eyrC mutant see PMID:16177356 negatively regulation of entry into macrophage B. abortus BvrS/BvrR mutant PMID: 9701808; PMID: 16077108 smooth Brucella repsonse to nurtient deprivation in marcophage smooth Brucella response to antimicrobial peptide smooth Brucella response to oxidative stress inside BCV smooth Brucella response to nitrosative stress inside BCV smooth Brucella response to acidity inside BCV negatively regulation of smooth Brucella response to acidity inside BCV negatively regulation of smooth Brucella response to nitrosative stress inside BCV negatively regulation of smooth Brucella response to oxidative stress inside BCV positively regulation of smooth Brucella response to antimicrobial peptide negatively regulation of smooth Brucella response to nurtient deprivation B. abortus sodC mutant See. PMID:15845493 mouse bone marrow-derived macrophage Brucella intracellular trafficking in macrophage smooth Brucella intracellular trafficking in macrophage rough Brucella intracellular trafficking in macrophage B. abortus znuA mutant See PMID:15472468 negatively regulation of Brucella intracellular trafficking in macrophage B. abortus virB1 mutant See. PMID 15322008 B. abortus virB2 mutant Brucella purine biosynthesis pathway B. abortus purE mutant See. PMID: 15271960 B. abortus purL mutant See. PMID: 15271960 B.abortus purD mutant See. PMID: 15271960 B. abortus ilvD mutant See. PMID: 15271960 Brucella ilvD gene Brucella branched chain family amino acid biosynthetic process subclass of GO:0009082 B. abortus pncA mutant See. PMID:15135535 Brucella wboA gene Brcuella metabolic process Brucella Glycosyl transferase B. abortus zwf mutant See PMID: 12761078 B. abortus hfq mutant See PMID:12730323 Brucella lipopolysaccharide biosynthetic process B.suis narG mutant See. PMID:12438693 The narG mutant was unable to produce nitrite from nitrate. B.suis glnA mutant See. PMID:12438693 B.suis glyA mutant See. PMID:12438693 Serine hydroxymethyltransferase B.suis hisD mutant See. PMID:12438693 B.suis hisF mutant See. PMID:12438693 B.suis leuA mutant See. PMID:12438693 B.suis leuC mutant See. PMID:12438693 B.suis lysA mutant See. PMID:12438693 B.suis serB mutant See. PMID:12438693 Brucella glycine metabolic process subclass of GO:glycine metabolic process 0006544 B.suis dut mutant See. PMID:12438693 B.suis uppS mutant See. PMID:12438693 B.suis miaA mutant See. PMID:12438693 B.suis cobW mutant See. PMID:12438693 Brucella one-carbon metabolic process subclass of GO: one-carbon metabolic process Brucella nucleotide metabolic process subclass of nucleotide metabolic process Brucella tRNA processing subclass of GO:tRNA processing Brucella glucose metabolic process subclass of GO:glucose metabolic process Brucella carbohydrate metabolic process subcalss of GO:carbohydrate metabolic process B.suis dnaK mutant B.abortus hemH mutant See PMID:11553564 negatively regulation of intracellular survival in macrophage Brucella porphyrin-containing compound biosynthetic process Brucella heme biosynthetic process subclass of GO: heme biosynthetic process B. suis aroC mutant See PMID:11119550 Brucella aromatic amino acid family biosynthetic process subclass of GO: 0009073 B.abortus bacA mutant B.suis pyc mutant B.suis pgi mutant See PMID:10678941 Brucella gluconeogenesis subcalss of GO: gluconeogenesis Brucella glycolysis subclass of GO: glycolysis B.suis glnD mutant See PMID:10678941 B.suis rpsA mutant See PMID 10678941 translation process in Brucella subclass of GO: translation B.suis virB8 mutant See PMID ;10678941 B.suis virB5 mutant See PMID:10510235 B.suis virB9 mutant See PMID:10510235 B.suis virB10 mutant See PMID:10510235 B.abortus htrA mutant See PMID: 8890248 process of establishing Brucella infection in dendritic cell process of establishing Brucella infection in epithelial cell macrophage - Brucella interaction host-Brucella interaction between macrophage and Brucella macrophage anti-Brucella process dendritic cell - Brucella interaction epithelial cell - Brucella interaction smooth LPS and macrophage lipid raft interaction engulfment of smooth Brucella by macrophage engulfment of Brucella by macrophage engulfment of rough Brucella by macrophage formation of early phagosome containing smooth Brucella formation of intermediate smooth Brucella containing phagosome acidification of smooth Brucella containing phagosome smooth Brucella containing phagosome fusion with ER membrane smooth Brucella intracellular replication in macrophage early phagosome containing smooth Brucella intermediate phagosome containing smooth Brucella acidic phagosome containing smooth Brucella ER-derived replication niche of smooth Brucella replicative phagosome containing smooth Brucella smooth Brucella entry into macrophage rough Brucella entry into macrophage smooth Brucella relsease from macrophage formation of early phagosome containing rough Brucella maturation of phagsome containing rough Brucella phagosome containing rough Brucella fusion with lysosome macrophage killing of Brucella early phagosome containing rough Brucella phagolysosome containing rough Brucella disposition of resistance to nutrient deprivation disposition of resistance to antimicrobial peptide disposition of resistance to oxidative stress disposition of resistance to nitrosative stress disposition of resistance to acidic stress smooth Brucella resistance to nutrient deprivation smooth Brucella resistance to antimicrobial peptide smooth Brucella resistance to oxidative stress inside BCV smooth Brucella resistance to nitrosative stress inside BCV smooth Brucella resistance to aicidity inside BCV Brucella containing vacuole BCV smooth Brucella containing vacuole BMEI0736 translocation of RicA into macrophage enzyme substrate role Brucella type IV secretion system T4SS, Brucella Brucella T4SS regulation of Brucella intracellular trafficking Brucella abortus SodC Brucella melitensis SodC Brucella abortus sodC gene Brucella protein coding gene that codes for SodC protein of Brucella abortus YL YL 6 weeks continuous doxycycline treatment duration of WHO standard for human brucellosis 42 YL, YH a continous treatment duration that includes 6 weeks of deoxycycline treatment. It's part of a WHO standard treatment for human brucellosis. 2 weeks continuous streptomycin treatment duration of WHO standard for human brucellosis 14 YL, YH a continous treatment duration that includes 2 weeks of streptomysin treatment. It's part of a WHO standard treatment for human brucellosis. 3 weeks continuous streptomycin treatment duration of WHO standard for human brucellosis 21 YL, YH a continous treatment duration that includes 3 weeks of streptomysin treatment. It's part of a WHO standard treatment for human brucellosis. Brucella protective antigen stimulated acquired immune response YL YL the adaptive immune response stimulated by Brucella protective antigen Brucella-specific protective T-cell mediated immune response The brucella protecitve antigen stimulated acquiref immune reponse that is mediated by T-cell YL YL OBI will change the difinition. Brucella's intracellular replication Brucella's intracellular persistence Brucella intracellular survival Strain RB51 has a rough colonial morphology and lacks the O polysaccharide of LPS. (Schurig, G. G., R. M. Roop II, T. Bagchi, S. Boyle, D. Buhrman, and N. Sriranganathan. 1991. Biological properties of RB51: a stable rough strain of Brucella abortus. Vet. Microbiol. 28:171–188.) LPS bacterial lipopolysaccharide Brucella melitensis bv. 1 str. 16M Brucella is a genus of Gram-negative bacteria.[1] They are small (0.5 to 0.7 by 0.6 to 1.5), non-motile, non-encapsulated coccobacilli, which function as facultative intracellular parasites. Brucella is the cause of brucellosis, which is a zoonosis. It is transmitted by ingesting infected food, direct contact with an infected animal, or inhalation of aerosols. Transmission from human to human, for example through sexual intercourse or from mother to child, is exceedingly rare, but possible.[2] Minimum infectious exposure is between 10 - 100 organisms. Brucellosis primarily occurs through occupational exposure (e.g. exposure to cattle, sheep, pigs), but also by consumption of unpasteurized milk products. There are a few different species of Brucella, each with slightly different host specificity. B.melitensis which infects goats and sheep, B. abortus which infects cattle, B. suis infects pigs, B.ovis infects sheep and B.neotomae. Recently new species were discovered, in marine mammals (B.pinnipedialis and B.ceti ), in the common vole Microtus arvalis (B.microti ), and even in a breast implant (B.inopinata ). However, the new NCBI taxonomy has named all Brucella species Brucella melitensis. They include Brucella melitensis 16M and 5 other biovars: abortus, canis, neotomae, ovis, and suis. http://en.wikipedia.org/wiki/Brucella most common cause of human brucellosis it is very rare cause of human brucellosis GACGAACGGAATTTTTCCAATCCC TGCCGATCACTTAAGGGCCTTCAT AAATCGCGTCCTTGCTGGTCTGA TGCCGATCACTTAAGGGCCTTCAT